Incidental Mutation 'R4075:Lrig3'
ID316529
Institutional Source Beutler Lab
Gene Symbol Lrig3
Ensembl Gene ENSMUSG00000020105
Gene Nameleucine-rich repeats and immunoglobulin-like domains 3
Synonyms9030421L11Rik, 9430095K15Rik, 9130004I02Rik
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location125966168-126015359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126013408 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 999 (T999I)
Ref Sequence ENSEMBL: ENSMUSP00000074360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074807]
PDB Structure
Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000074807
AA Change: T999I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: T999I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219974
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Lrig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lrig3 APN 10 126013148 missense probably benign 0.00
IGL00426:Lrig3 APN 10 125972137 nonsense probably null
IGL00969:Lrig3 APN 10 125997115 missense probably damaging 1.00
IGL01376:Lrig3 APN 10 125994466 missense probably benign 0.01
IGL01510:Lrig3 APN 10 126008698 missense probably damaging 1.00
IGL01825:Lrig3 APN 10 126010017 missense probably damaging 0.98
IGL02231:Lrig3 APN 10 125997172 missense probably damaging 1.00
IGL02377:Lrig3 APN 10 126014874 missense probably benign 0.00
IGL02648:Lrig3 APN 10 125966594 missense probably benign
IGL02832:Lrig3 APN 10 126007002 missense probably benign 0.37
IGL03266:Lrig3 APN 10 126013282 missense probably benign 0.28
R0023:Lrig3 UTSW 10 126010219 missense probably damaging 1.00
R0129:Lrig3 UTSW 10 126006943 missense probably damaging 1.00
R0183:Lrig3 UTSW 10 126010192 missense probably damaging 1.00
R0226:Lrig3 UTSW 10 125972117 splice site probably benign
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0336:Lrig3 UTSW 10 125966705 missense probably benign 0.04
R0348:Lrig3 UTSW 10 126013448 nonsense probably null
R0502:Lrig3 UTSW 10 126008736 missense probably damaging 1.00
R0639:Lrig3 UTSW 10 126010221 missense probably damaging 1.00
R1099:Lrig3 UTSW 10 126007014 splice site probably null
R1220:Lrig3 UTSW 10 125997076 missense probably damaging 1.00
R1230:Lrig3 UTSW 10 126002971 missense probably damaging 1.00
R1398:Lrig3 UTSW 10 126003088 missense probably benign 0.00
R1451:Lrig3 UTSW 10 126010057 missense possibly damaging 0.92
R1523:Lrig3 UTSW 10 126008698 missense probably damaging 1.00
R1545:Lrig3 UTSW 10 126008547 missense possibly damaging 0.80
R1661:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1665:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1673:Lrig3 UTSW 10 126010167 missense probably damaging 1.00
R1778:Lrig3 UTSW 10 126010075 missense probably damaging 1.00
R1800:Lrig3 UTSW 10 125997051 splice site probably null
R1840:Lrig3 UTSW 10 126013389 nonsense probably null
R1882:Lrig3 UTSW 10 126009825 missense possibly damaging 0.89
R1900:Lrig3 UTSW 10 126002393 splice site probably benign
R2160:Lrig3 UTSW 10 125997696 missense possibly damaging 0.95
R2200:Lrig3 UTSW 10 125996609 splice site probably null
R2294:Lrig3 UTSW 10 125966494 nonsense probably null
R2518:Lrig3 UTSW 10 125994441 missense probably benign 0.07
R3037:Lrig3 UTSW 10 126010032 missense probably damaging 1.00
R3236:Lrig3 UTSW 10 125997187 missense probably damaging 1.00
R4073:Lrig3 UTSW 10 126013408 missense probably benign
R4074:Lrig3 UTSW 10 126013408 missense probably benign
R4077:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4079:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4405:Lrig3 UTSW 10 126011008 missense probably benign 0.00
R4425:Lrig3 UTSW 10 126013404 missense probably benign 0.00
R4505:Lrig3 UTSW 10 126013347 missense probably benign 0.00
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4903:Lrig3 UTSW 10 125996613 critical splice acceptor site probably null
R5201:Lrig3 UTSW 10 126013151 missense possibly damaging 0.48
R5307:Lrig3 UTSW 10 126006690 missense probably damaging 1.00
R5402:Lrig3 UTSW 10 126008740 missense probably damaging 1.00
R5557:Lrig3 UTSW 10 125972134 missense probably damaging 1.00
R5792:Lrig3 UTSW 10 126009919 missense probably damaging 1.00
R5903:Lrig3 UTSW 10 126008478 missense probably damaging 1.00
R6280:Lrig3 UTSW 10 126010979 missense probably benign 0.18
R6484:Lrig3 UTSW 10 125996609 splice site probably null
R6985:Lrig3 UTSW 10 126014869 missense possibly damaging 0.64
R7089:Lrig3 UTSW 10 125997124 missense probably damaging 1.00
R7177:Lrig3 UTSW 10 126006843 missense probably benign 0.02
R7347:Lrig3 UTSW 10 126009966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAACTTGAAAAGGTTGCAGC -3'
(R):5'- ACCCAAGTGTATTTCAGAAGCGC -3'

Sequencing Primer
(F):5'- CTTGAAAAGGTTGCAGCTCTGACC -3'
(R):5'- GGATTTAGAACTCACAGGATCTCACG -3'
Posted On2015-05-15