Incidental Mutation 'R4075:Ikzf3'
ID316530
Institutional Source Beutler Lab
Gene Symbol Ikzf3
Ensembl Gene ENSMUSG00000018168
Gene NameIKAROS family zinc finger 3
SynonymsZfpn1a3, Aiolos, 5830411O07Rik
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98464902-98546031 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 98467643 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 289 (Y289*)
Ref Sequence ENSEMBL: ENSMUSP00000099430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103141]
Predicted Effect probably null
Transcript: ENSMUST00000103141
AA Change: Y289*
SMART Domains Protein: ENSMUSP00000099430
Gene: ENSMUSG00000018168
AA Change: Y289*

DomainStartEndE-ValueType
ZnF_C2H2 117 139 4.34e0 SMART
ZnF_C2H2 145 167 8.02e-5 SMART
ZnF_C2H2 173 195 4.47e-3 SMART
ZnF_C2H2 201 221 7.11e0 SMART
ZnF_C2H2 450 472 7.11e0 SMART
ZnF_C2H2 478 502 1.64e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153902
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutants exhibit greatly reduced B cell populations in the peritoneum, marginal zone and recirculating bone marrow. Aging mutants express autoantibodies, frequently develop B cell lymphomas, and display symptoms characteristic of SLE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Ikzf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Ikzf3 APN 11 98488857 missense probably damaging 1.00
IGL01537:Ikzf3 APN 11 98516892 missense probably damaging 1.00
IGL03376:Ikzf3 APN 11 98488953 missense probably damaging 1.00
R0030:Ikzf3 UTSW 11 98467612 missense probably benign 0.01
R0266:Ikzf3 UTSW 11 98467317 missense probably benign
R1302:Ikzf3 UTSW 11 98516920 missense probably benign
R1464:Ikzf3 UTSW 11 98516905 missense probably benign 0.00
R1464:Ikzf3 UTSW 11 98516905 missense probably benign 0.00
R1500:Ikzf3 UTSW 11 98518695 missense probably benign 0.16
R1531:Ikzf3 UTSW 11 98490446 missense probably damaging 0.98
R1599:Ikzf3 UTSW 11 98467093 missense probably damaging 1.00
R1623:Ikzf3 UTSW 11 98490331 critical splice donor site probably null
R2154:Ikzf3 UTSW 11 98485649 nonsense probably null
R3915:Ikzf3 UTSW 11 98490586 missense probably damaging 1.00
R4004:Ikzf3 UTSW 11 98489017 missense probably damaging 1.00
R4005:Ikzf3 UTSW 11 98489017 missense probably damaging 1.00
R4210:Ikzf3 UTSW 11 98490487 missense probably benign 0.00
R4804:Ikzf3 UTSW 11 98490574 missense probably benign 0.20
R5107:Ikzf3 UTSW 11 98490476 missense probably damaging 1.00
R5266:Ikzf3 UTSW 11 98490580 missense probably benign 0.11
R5267:Ikzf3 UTSW 11 98490580 missense probably benign 0.11
R5450:Ikzf3 UTSW 11 98467086 missense probably damaging 1.00
R6237:Ikzf3 UTSW 11 98467053 missense probably damaging 1.00
R6557:Ikzf3 UTSW 11 98516881 missense probably benign
R7832:Ikzf3 UTSW 11 98518699 missense probably benign
R8058:Ikzf3 UTSW 11 98516927 nonsense probably null
R8073:Ikzf3 UTSW 11 98467429 missense probably benign 0.05
Z1176:Ikzf3 UTSW 11 98467181 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGTGCTATGGGGTACACACTG -3'
(R):5'- CACCCCTAAACATGTGACTGATG -3'

Sequencing Primer
(F):5'- TACACACTGCTGATGACTGG -3'
(R):5'- ATGTGACTGATGTACCCCCTGAG -3'
Posted On2015-05-15