Incidental Mutation 'R4075:Mtr'
ID316531
Institutional Source Beutler Lab
Gene Symbol Mtr
Ensembl Gene ENSMUSG00000021311
Gene Name5-methyltetrahydrofolate-homocysteine methyltransferase
Synonymsmethionine synthase, D830038K18Rik, MS
MMRRC Submission 040974-MU
Accession Numbers

Genbank: NM_001081128

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location12182712-12258113 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 12215412 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099856] [ENSMUST00000221290]
Predicted Effect probably null
Transcript: ENSMUST00000099856
SMART Domains Protein: ENSMUSP00000097442
Gene: ENSMUSG00000021311

DomainStartEndE-ValueType
Pfam:S-methyl_trans 18 326 1.5e-93 PFAM
Pfam:Pterin_bind 363 601 4.6e-63 PFAM
B12-binding_2 657 743 6.42e-41 SMART
Pfam:B12-binding 761 861 3.3e-20 PFAM
Pfam:Met_synt_B12 953 1234 2.5e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221290
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 5-methyltetrahydrofolate-homocysteine methyltransferase. This enzyme, also known as cobalamin-dependent methionine synthase, catalyzes the final step in methionine biosynthesis. Mutations in MTR have been identified as the underlying cause of methylcobalamin deficiency complementation group G. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit embryonic lethality prior to E9.5. Heterozygous appear mostly similar to conrtols, except that they exhibit elevated plasma methionine and homocysteine levels. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Mtr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Mtr APN 13 12225650 splice site probably benign
IGL02456:Mtr APN 13 12199094 missense probably damaging 0.98
IGL02573:Mtr APN 13 12199127 missense possibly damaging 0.95
IGL02642:Mtr APN 13 12195232 splice site probably benign
IGL03005:Mtr APN 13 12235449 splice site probably benign
IGL03017:Mtr APN 13 12247891 critical splice donor site probably null
IGL03036:Mtr APN 13 12247377 missense probably damaging 1.00
H8930:Mtr UTSW 13 12235460 missense probably damaging 1.00
PIT4431001:Mtr UTSW 13 12212443 missense probably damaging 1.00
PIT4520001:Mtr UTSW 13 12197985 nonsense probably null
R0011:Mtr UTSW 13 12238052 splice site probably benign
R0047:Mtr UTSW 13 12222226 missense probably damaging 1.00
R0047:Mtr UTSW 13 12222226 missense probably damaging 1.00
R0304:Mtr UTSW 13 12222154 critical splice donor site probably null
R0617:Mtr UTSW 13 12221432 missense probably benign
R0842:Mtr UTSW 13 12200247 missense probably damaging 1.00
R1101:Mtr UTSW 13 12189525 missense possibly damaging 0.84
R1450:Mtr UTSW 13 12193733 missense probably damaging 0.99
R1534:Mtr UTSW 13 12235544 splice site probably benign
R1907:Mtr UTSW 13 12225532 missense probably damaging 1.00
R2111:Mtr UTSW 13 12244601 missense possibly damaging 0.86
R2354:Mtr UTSW 13 12188157 splice site probably benign
R3849:Mtr UTSW 13 12247365 missense probably benign 0.16
R3899:Mtr UTSW 13 12216849 missense probably benign 0.00
R4012:Mtr UTSW 13 12189397 missense probably damaging 1.00
R4012:Mtr UTSW 13 12189398 missense probably damaging 1.00
R4091:Mtr UTSW 13 12231057 missense probably damaging 1.00
R4655:Mtr UTSW 13 12227793 missense probably damaging 1.00
R4801:Mtr UTSW 13 12195251 missense probably benign 0.01
R4802:Mtr UTSW 13 12195251 missense probably benign 0.01
R4895:Mtr UTSW 13 12216866 missense probably benign 0.01
R5481:Mtr UTSW 13 12188155 critical splice acceptor site probably null
R5966:Mtr UTSW 13 12215567 critical splice acceptor site probably null
R6209:Mtr UTSW 13 12190392 missense probably benign 0.00
R6348:Mtr UTSW 13 12247954 missense possibly damaging 0.49
R6463:Mtr UTSW 13 12216866 missense probably benign 0.01
R6467:Mtr UTSW 13 12188106 missense probably damaging 1.00
R7046:Mtr UTSW 13 12190209 missense possibly damaging 0.58
R7505:Mtr UTSW 13 12221476 missense probably benign 0.02
R7575:Mtr UTSW 13 12199077 missense probably benign 0.01
R7705:Mtr UTSW 13 12249896 missense probably benign
R7748:Mtr UTSW 13 12227839 missense probably benign 0.00
R8161:Mtr UTSW 13 12221486 missense probably damaging 0.99
R8290:Mtr UTSW 13 12190253 missense probably damaging 1.00
X0064:Mtr UTSW 13 12250657 missense probably damaging 1.00
Z1177:Mtr UTSW 13 12187049 missense probably benign 0.32
Z1177:Mtr UTSW 13 12249866 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCTAAGAATGTCTGCAAGC -3'
(R):5'- CTTCAGCATGCCTGTGATTC -3'

Sequencing Primer
(F):5'- GAATGTCTGCAAGCTTTCTAACTTG -3'
(R):5'- AGCATGCCTGTGATTCATTCTTTG -3'
Posted On2015-05-15