Incidental Mutation 'R4075:Ercc4'
ID316535
Institutional Source Beutler Lab
Gene Symbol Ercc4
Ensembl Gene ENSMUSG00000022545
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 4
SynonymsXpf
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location13109684-13150617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13130685 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 499 (V499I)
Ref Sequence ENSEMBL: ENSMUSP00000114639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023206] [ENSMUST00000129049] [ENSMUST00000141024]
Predicted Effect probably damaging
Transcript: ENSMUST00000023206
AA Change: V589I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023206
Gene: ENSMUSG00000022545
AA Change: V589I

DomainStartEndE-ValueType
Blast:DEXDc 8 187 1e-5 BLAST
ERCC4 684 764 1.11e-26 SMART
low complexity region 789 802 N/A INTRINSIC
PDB:2AQ0|B 835 917 6e-37 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000129049
AA Change: V499I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000141024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156393
Meta Mutation Damage Score 0.2922 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice show impaired growth and do not survive longer than several weeks of age. Cultutred cells obtained from mutant mice were shown to be hypersensitive to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Ercc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Ercc4 APN 16 13125369 missense possibly damaging 0.91
IGL00805:Ercc4 APN 16 13122004 missense possibly damaging 0.77
IGL01348:Ercc4 APN 16 13132934 missense probably damaging 1.00
IGL02406:Ercc4 APN 16 13123536 missense probably damaging 1.00
IGL03248:Ercc4 APN 16 13127593 missense probably damaging 1.00
Rapscallion UTSW 16 13126467 missense probably benign
Rascal UTSW 16 13132947 missense probably damaging 1.00
PIT4812001:Ercc4 UTSW 16 13144447 missense probably benign 0.29
R0212:Ercc4 UTSW 16 13123332 critical splice acceptor site probably null
R0505:Ercc4 UTSW 16 13126467 missense probably benign
R0962:Ercc4 UTSW 16 13130146 missense probably damaging 0.99
R1078:Ercc4 UTSW 16 13130197 missense probably benign 0.00
R1356:Ercc4 UTSW 16 13125282 missense probably damaging 0.99
R1420:Ercc4 UTSW 16 13130209 missense probably benign 0.01
R1554:Ercc4 UTSW 16 13147622 missense probably damaging 1.00
R1899:Ercc4 UTSW 16 13147787 missense probably damaging 1.00
R2128:Ercc4 UTSW 16 13147934 missense probably damaging 0.99
R2214:Ercc4 UTSW 16 13110024 missense probably damaging 1.00
R3757:Ercc4 UTSW 16 13144496 missense probably benign 0.28
R4072:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4073:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4076:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4646:Ercc4 UTSW 16 13147574 missense probably damaging 1.00
R4731:Ercc4 UTSW 16 13147607 missense probably damaging 1.00
R4756:Ercc4 UTSW 16 13123423 missense probably damaging 1.00
R4767:Ercc4 UTSW 16 13122095 missense probably damaging 1.00
R5011:Ercc4 UTSW 16 13123581 intron probably benign
R5013:Ercc4 UTSW 16 13123581 intron probably benign
R5301:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R5308:Ercc4 UTSW 16 13130164 missense probably damaging 1.00
R5684:Ercc4 UTSW 16 13130601 missense probably benign 0.35
R6083:Ercc4 UTSW 16 13110039 nonsense probably null
R6092:Ercc4 UTSW 16 13125261 missense probably benign 0.04
R6815:Ercc4 UTSW 16 13123435 missense probably damaging 0.99
R6953:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R7062:Ercc4 UTSW 16 13132947 missense probably damaging 1.00
R7199:Ercc4 UTSW 16 13147793 missense probably damaging 1.00
R7317:Ercc4 UTSW 16 13122113 missense probably benign 0.12
R7858:Ercc4 UTSW 16 13125305 missense probably damaging 0.98
R7948:Ercc4 UTSW 16 13130185 missense probably benign 0.00
R8245:Ercc4 UTSW 16 13130137 missense probably benign 0.00
R8408:Ercc4 UTSW 16 13130137 missense probably benign 0.00
R8409:Ercc4 UTSW 16 13130137 missense probably benign 0.00
RF007:Ercc4 UTSW 16 13123507 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGCAGACAGACCAGTAGTAGCC -3'
(R):5'- TCCATCTGGAACGTTCTATCG -3'

Sequencing Primer
(F):5'- GGTAGAGATTAAGCGTGAATCATTTG -3'
(R):5'- GTTCTATCGTTCACCAGAAAGCAG -3'
Posted On2015-05-15