Incidental Mutation 'R4075:Tab3'
ID316542
Institutional Source Beutler Lab
Gene Symbol Tab3
Ensembl Gene ENSMUSG00000035476
Gene NameTGF-beta activated kinase 1/MAP3K7 binding protein 3
Synonyms4921526G09Rik, Map3k7ip3
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4075 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location85574022-85634469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85614457 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 197 (V197F)
Ref Sequence ENSEMBL: ENSMUSP00000039668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048250] [ENSMUST00000137438] [ENSMUST00000146063]
PDB Structure
Crystal structure of the mouse TAB3-NZF in complex with Lys63-linked di-ubiquitin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048250
AA Change: V197F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039668
Gene: ENSMUSG00000035476
AA Change: V197F

DomainStartEndE-ValueType
CUE 8 50 3.16e-8 SMART
low complexity region 152 162 N/A INTRINSIC
low complexity region 175 183 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 294 307 N/A INTRINSIC
low complexity region 409 422 N/A INTRINSIC
coiled coil region 521 600 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
ZnF_RBZ 689 713 4.97e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137438
SMART Domains Protein: ENSMUSP00000117932
Gene: ENSMUSG00000035476

DomainStartEndE-ValueType
CUE 8 50 3.16e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146063
Meta Mutation Damage Score 0.1450 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene functions in the NF-kappaB signal transduction pathway. The encoded protein, and the similar and functionally redundant protein MAP3K7IP2/TAB2, forms a ternary complex with the protein kinase MAP3K7/TAK1 and either TRAF2 or TRAF6 in response to stimulation with the pro-inflammatory cytokines TNF or IL-1. Subsequent MAP3K7/TAK1 kinase activity triggers a signaling cascade leading to activation of the NF-kappaB transcription factor. The human genome contains a related pseudogene. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele appear normal at E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Tab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Tab3 APN X 85621604 missense probably damaging 0.98
IGL02631:Tab3 APN X 85614533 missense probably benign 0.02
R3499:Tab3 UTSW X 85615121 missense probably benign 0.10
R4073:Tab3 UTSW X 85614457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTACTCCCAACTATAATCCG -3'
(R):5'- AAAGGACGCTGGCTGTAATG -3'

Sequencing Primer
(F):5'- CCATCTTCCATGCAAACAG -3'
(R):5'- GCTGGCTGTAATGAGGCAC -3'
Posted On2015-05-15