Incidental Mutation 'R4076:Rev1'
ID 316545
Institutional Source Beutler Lab
Gene Symbol Rev1
Ensembl Gene ENSMUSG00000026082
Gene Name REV1, DNA directed polymerase
Synonyms REV1, Rev1l, 1110027I23Rik
MMRRC Submission 040975-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.904) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 38052786-38129801 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 38054238 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 1075 (K1075T)
Ref Sequence ENSEMBL: ENSMUSP00000027251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000027252]
AlphaFold Q920Q2
PDB Structure Solution structure of the mouse Rev1 C-terminal domain [SOLUTION NMR]
Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa [SOLUTION NMR]
Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027251
AA Change: K1075T

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082
AA Change: K1075T

DomainStartEndE-ValueType
BRCT 46 121 3.99e-13 SMART
low complexity region 320 342 N/A INTRINSIC
Pfam:IMS 420 620 1.9e-43 PFAM
Pfam:IMS_C 700 831 5.8e-20 PFAM
low complexity region 888 901 N/A INTRINSIC
Pfam:DUF4414 938 1071 9.7e-11 PFAM
Pfam:REV1_C 1127 1248 1.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027252
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194650
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the S. cerevisiae mutagenesis protein Rev1. The Rev1 proteins contain a BRCT domain, which is important in protein-protein interactions. A suggested role for the human Rev1-like protein is as a scaffold that recruits DNA polymerases involved in translesion synthesis (TLS) of damaged DNA. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal somatic hypermutation frequency of the Ig gene. Mice homozygous for a knock-out allele exhibit background-sensitive prenatal lethality and abnormal somatic hypermutation frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Rev1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Rev1 APN 1 38098940 missense probably damaging 1.00
IGL01065:Rev1 APN 1 38099009 missense possibly damaging 0.89
IGL01393:Rev1 APN 1 38092063 missense probably damaging 1.00
IGL03003:Rev1 APN 1 38088073 missense possibly damaging 0.77
H8562:Rev1 UTSW 1 38056767 missense probably damaging 0.96
PIT1430001:Rev1 UTSW 1 38056256 unclassified probably benign
R0409:Rev1 UTSW 1 38074368 nonsense probably null
R0606:Rev1 UTSW 1 38059123 missense probably null 1.00
R1134:Rev1 UTSW 1 38057687 missense probably benign 0.04
R1171:Rev1 UTSW 1 38088500 missense possibly damaging 0.89
R1208:Rev1 UTSW 1 38059118 unclassified probably benign
R1440:Rev1 UTSW 1 38088205 missense probably damaging 1.00
R1485:Rev1 UTSW 1 38088572 missense probably benign 0.00
R1627:Rev1 UTSW 1 38055490 missense probably damaging 0.99
R3845:Rev1 UTSW 1 38098988 missense probably damaging 0.99
R3948:Rev1 UTSW 1 38074333 missense possibly damaging 0.69
R4074:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4075:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4248:Rev1 UTSW 1 38107648 missense possibly damaging 0.87
R4293:Rev1 UTSW 1 38108419 missense possibly damaging 0.89
R4548:Rev1 UTSW 1 38059194 missense possibly damaging 0.72
R4610:Rev1 UTSW 1 38053649 missense probably damaging 1.00
R4654:Rev1 UTSW 1 38079256 intron probably benign
R5032:Rev1 UTSW 1 38074489 intron probably benign
R5286:Rev1 UTSW 1 38055326 nonsense probably null
R5311:Rev1 UTSW 1 38079393 missense probably benign 0.00
R5327:Rev1 UTSW 1 38108451 nonsense probably null
R6363:Rev1 UTSW 1 38071489 missense probably damaging 1.00
R7050:Rev1 UTSW 1 38054271 missense probably damaging 1.00
R7072:Rev1 UTSW 1 38067545 nonsense probably null
R7132:Rev1 UTSW 1 38071449 missense possibly damaging 0.95
R7264:Rev1 UTSW 1 38085601 missense probably damaging 1.00
R7298:Rev1 UTSW 1 38053104 missense probably damaging 1.00
R7367:Rev1 UTSW 1 38074407 nonsense probably null
R7395:Rev1 UTSW 1 38088065 missense possibly damaging 0.69
R7829:Rev1 UTSW 1 38056445 missense probably damaging 0.98
R8053:Rev1 UTSW 1 38063141 missense possibly damaging 0.67
R8093:Rev1 UTSW 1 38075016 intron probably benign
R8356:Rev1 UTSW 1 38059243 nonsense probably null
R8456:Rev1 UTSW 1 38059243 nonsense probably null
R8461:Rev1 UTSW 1 38083787 missense possibly damaging 0.56
R8724:Rev1 UTSW 1 38088069 missense probably damaging 1.00
R8757:Rev1 UTSW 1 38059272 missense probably damaging 1.00
R8759:Rev1 UTSW 1 38059272 missense probably damaging 1.00
R8945:Rev1 UTSW 1 38083743 missense probably damaging 0.98
R9309:Rev1 UTSW 1 38054864 missense probably damaging 1.00
R9433:Rev1 UTSW 1 38053092 missense probably damaging 1.00
R9500:Rev1 UTSW 1 38063133 nonsense probably null
X0017:Rev1 UTSW 1 38053661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACGAGAATGCTGTATTCAGAC -3'
(R):5'- TTTATGCCTTAAGCCACGGC -3'

Sequencing Primer
(F):5'- CTGTATTCAGACAGTGTCAAGTAC -3'
(R):5'- GCGTGCCTGGCCTTCTTTC -3'
Posted On 2015-05-15