Incidental Mutation 'R4076:Scg2'
ID 316546
Institutional Source Beutler Lab
Gene Symbol Scg2
Ensembl Gene ENSMUSG00000050711
Gene Name secretogranin II
Synonyms SgII, Chgc
MMRRC Submission 040975-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 79434669-79440120 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 79436857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 50 (F50V)
Ref Sequence ENSEMBL: ENSMUSP00000139740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049972] [ENSMUST00000185234]
AlphaFold Q03517
Predicted Effect probably benign
Transcript: ENSMUST00000049972
AA Change: F50V

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000062556
Gene: ENSMUSG00000050711
AA Change: F50V

DomainStartEndE-ValueType
Pfam:Granin 27 614 7.2e-235 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185234
AA Change: F50V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139740
Gene: ENSMUSG00000050711
AA Change: F50V

DomainStartEndE-ValueType
Pfam:Granin 27 319 1.4e-123 PFAM
Pfam:Granin 316 574 7.1e-91 PFAM
Meta Mutation Damage Score 0.2026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Scg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Scg2 APN 1 79436821 missense probably benign 0.16
IGL02083:Scg2 APN 1 79436224 missense probably benign 0.00
IGL02316:Scg2 APN 1 79435681 missense probably damaging 1.00
IGL02338:Scg2 APN 1 79436493 missense possibly damaging 0.93
R0281:Scg2 UTSW 1 79435512 missense possibly damaging 0.95
R0384:Scg2 UTSW 1 79435549 missense probably benign 0.42
R0501:Scg2 UTSW 1 79435603 missense probably damaging 1.00
R0909:Scg2 UTSW 1 79435782 missense possibly damaging 0.74
R1773:Scg2 UTSW 1 79435635 missense probably benign 0.04
R2254:Scg2 UTSW 1 79436500 missense probably damaging 1.00
R4074:Scg2 UTSW 1 79436857 missense probably damaging 0.97
R4097:Scg2 UTSW 1 79435821 missense probably damaging 0.99
R4560:Scg2 UTSW 1 79435181 missense probably damaging 1.00
R4621:Scg2 UTSW 1 79436664 missense probably benign 0.08
R4876:Scg2 UTSW 1 79435919 missense probably damaging 1.00
R4944:Scg2 UTSW 1 79436476 nonsense probably null
R5829:Scg2 UTSW 1 79436920 missense probably damaging 1.00
R6158:Scg2 UTSW 1 79435400 missense probably damaging 1.00
R6248:Scg2 UTSW 1 79436306 missense probably benign 0.29
R6365:Scg2 UTSW 1 79435300 missense probably benign
R6459:Scg2 UTSW 1 79436290 missense probably damaging 1.00
R6676:Scg2 UTSW 1 79435782 missense possibly damaging 0.74
R6693:Scg2 UTSW 1 79436020 missense probably benign 0.01
R7259:Scg2 UTSW 1 79436985 missense probably benign
R7393:Scg2 UTSW 1 79435231 missense probably damaging 1.00
R7578:Scg2 UTSW 1 79436895 missense probably damaging 0.99
R7608:Scg2 UTSW 1 79436181 missense probably benign 0.00
R8166:Scg2 UTSW 1 79435583 missense possibly damaging 0.56
R8247:Scg2 UTSW 1 79436519 missense possibly damaging 0.92
R8296:Scg2 UTSW 1 79435505 missense probably benign 0.13
R8308:Scg2 UTSW 1 79436859 missense probably benign 0.18
R8789:Scg2 UTSW 1 79435783 missense probably benign 0.05
R9252:Scg2 UTSW 1 79436352 missense probably damaging 0.98
R9286:Scg2 UTSW 1 79435936 missense probably damaging 1.00
R9489:Scg2 UTSW 1 79435219 missense probably damaging 1.00
R9605:Scg2 UTSW 1 79435219 missense probably damaging 1.00
Z1176:Scg2 UTSW 1 79436789 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCCTCGAGTATTATCCGCATCC -3'
(R):5'- CGTGCCTTCAAGCTCGTATC -3'

Sequencing Primer
(F):5'- GAGTATTATCCGCATCCACTCG -3'
(R):5'- GTGCCTTCAAGCTCGTATCATCTG -3'
Posted On 2015-05-15