Incidental Mutation 'R4076:Cd48'
ID 316547
Institutional Source Beutler Lab
Gene Symbol Cd48
Ensembl Gene ENSMUSG00000015355
Gene Name CD48 antigen
Synonyms Bcm-1, BCM1, BLAST-1, Sgp-60
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 171682009-171705258 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 171695883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 98 (V98D)
Ref Sequence ENSEMBL: ENSMUSP00000064241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015499] [ENSMUST00000068584]
AlphaFold P18181
PDB Structure Structure of NK cell receptor 2B4 (CD244) bound to its ligand CD48 [X-RAY DIFFRACTION]
Structure of NK cell receptor ligand CD48 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000015499
AA Change: V98D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015499
Gene: ENSMUSG00000015355
AA Change: V98D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 28 125 1.96e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068584
AA Change: V98D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064241
Gene: ENSMUSG00000015355
AA Change: V98D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 28 125 1.96e-6 SMART
IG_like 136 211 1.24e2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in a slight increase in CD4+CD8- thymocytes and impaired T cell proliferation in response to mitogens, anti-CD3 antibodies, and alloantigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Cd48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Cd48 APN 1 171695739 missense possibly damaging 0.95
IGL03140:Cd48 APN 1 171695883 missense probably damaging 1.00
R0311:Cd48 UTSW 1 171699580 nonsense probably null
R0490:Cd48 UTSW 1 171704877 makesense probably null
R1365:Cd48 UTSW 1 171699561 missense probably damaging 0.98
R1503:Cd48 UTSW 1 171695847 missense probably damaging 1.00
R1626:Cd48 UTSW 1 171682119 missense probably benign 0.30
R1628:Cd48 UTSW 1 171704852 missense probably damaging 0.99
R4753:Cd48 UTSW 1 171699588 missense probably damaging 0.99
R5488:Cd48 UTSW 1 171695705 missense possibly damaging 0.94
R6365:Cd48 UTSW 1 171682164 missense probably null 0.84
R7216:Cd48 UTSW 1 171695822 missense probably damaging 1.00
R7400:Cd48 UTSW 1 171695925 missense probably benign 0.00
R7702:Cd48 UTSW 1 171695780 missense probably damaging 0.99
R8041:Cd48 UTSW 1 171699390 missense probably damaging 0.99
R9424:Cd48 UTSW 1 171704864 missense possibly damaging 0.92
Z1088:Cd48 UTSW 1 171695727 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GACTTTCCTTGGCAGGTCATTC -3'
(R):5'- AGGTCAGGCTCACTCTCAAC -3'

Sequencing Primer
(F):5'- CTTGGCAGGTCATTCAATACCAG -3'
(R):5'- GGTCAGGCTCACTCTCAACTAGATG -3'
Posted On 2015-05-15