Incidental Mutation 'R4076:Dnali1'
ID 316553
Institutional Source Beutler Lab
Gene Symbol Dnali1
Ensembl Gene ENSMUSG00000042707
Gene Name dynein, axonemal, light intermediate polypeptide 1
Synonyms
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 125055338-125065703 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125059470 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 188 (D188G)
Ref Sequence ENSEMBL: ENSMUSP00000047783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030684] [ENSMUST00000036383]
AlphaFold Q8BVN8
Predicted Effect probably benign
Transcript: ENSMUST00000030684
SMART Domains Protein: ENSMUSP00000030684
Gene: ENSMUSG00000028869

DomainStartEndE-ValueType
Pfam:NGP1NT 43 174 1.2e-51 PFAM
SCOP:d1egaa1 178 261 8e-3 SMART
Pfam:FeoB_N 311 398 3.1e-6 PFAM
Pfam:MMR_HSR1 312 432 3.4e-13 PFAM
low complexity region 480 500 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
low complexity region 679 687 N/A INTRINSIC
low complexity region 700 710 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000036383
AA Change: D188G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047783
Gene: ENSMUSG00000042707
AA Change: D188G

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:Ax_dynein_light 66 252 1.2e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147550
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human homolog of the Chlamydomonas inner dynein arm gene, p28. The precise function of this gene is not known, however, it is a potential candidate for immotile cilia syndrome (ICS). Ultrastructural defects of the inner dynein arms are seen in patients with ICS. Immotile mutant strains of Chlamydomonas, a biflagellated algae, exhibit similar defects. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Dnali1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02624:Dnali1 APN 4 125058998 missense probably benign 0.05
R0841:Dnali1 UTSW 4 125065547 missense possibly damaging 0.83
R1145:Dnali1 UTSW 4 125065547 missense possibly damaging 0.83
R1145:Dnali1 UTSW 4 125065547 missense possibly damaging 0.83
R2035:Dnali1 UTSW 4 125059110 missense probably damaging 0.97
R5699:Dnali1 UTSW 4 125059050 missense possibly damaging 0.57
R7584:Dnali1 UTSW 4 125065538 missense probably benign 0.17
R8022:Dnali1 UTSW 4 125065530 missense possibly damaging 0.91
R8359:Dnali1 UTSW 4 125063667 missense probably damaging 1.00
R8843:Dnali1 UTSW 4 125063621 missense probably damaging 1.00
R9644:Dnali1 UTSW 4 125056609 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCGACCTAAGGCAATGC -3'
(R):5'- GTTGGAAGACGAACTGATCCG -3'

Sequencing Primer
(F):5'- AATGCCAGGGTGTGCACTG -3'
(R):5'- GGGAGGTCACCATCAACTG -3'
Posted On 2015-05-15