Incidental Mutation 'R4076:Nars2'
ID 316562
Institutional Source Beutler Lab
Gene Symbol Nars2
Ensembl Gene ENSMUSG00000018995
Gene Name asparaginyl-tRNA synthetase 2 (mitochondrial)(putative)
Synonyms
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 96951505-97064758 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 96958094 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 91 (S91T)
Ref Sequence ENSEMBL: ENSMUSP00000102777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044466] [ENSMUST00000107159]
AlphaFold Q8BGV0
Predicted Effect probably damaging
Transcript: ENSMUST00000044466
AA Change: S91T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044937
Gene: ENSMUSG00000018995
AA Change: S91T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:tRNA_anti-codon 44 118 2.4e-12 PFAM
Pfam:tRNA-synt_2 135 472 1.4e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107159
AA Change: S91T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102777
Gene: ENSMUSG00000018995
AA Change: S91T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:tRNA_anti-codon 44 118 7.6e-14 PFAM
Pfam:tRNA-synt_2 135 390 5.4e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149204
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of asparagine to tRNA molecules. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency 24 (COXPD24). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Nars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Nars2 APN 7 97031579 missense probably benign 0.00
IGL00796:Nars2 APN 7 97031580 missense probably benign 0.40
IGL00990:Nars2 APN 7 97002790 splice site probably benign
IGL02954:Nars2 APN 7 97039893 splice site probably null
IGL03256:Nars2 APN 7 97039910 missense possibly damaging 0.67
IGL03394:Nars2 APN 7 97040013 missense possibly damaging 0.94
R0600:Nars2 UTSW 7 97039923 missense probably damaging 1.00
R0943:Nars2 UTSW 7 96955931 splice site probably benign
R1389:Nars2 UTSW 7 97002829 missense probably benign
R4397:Nars2 UTSW 7 96973564 critical splice donor site probably null
R4758:Nars2 UTSW 7 96973528 missense probably damaging 1.00
R4771:Nars2 UTSW 7 97035245 missense probably damaging 1.00
R4908:Nars2 UTSW 7 97023741 missense probably benign 0.07
R5162:Nars2 UTSW 7 97059820 utr 3 prime probably benign
R6209:Nars2 UTSW 7 97057521 missense probably benign 0.00
R7464:Nars2 UTSW 7 97039930 missense probably benign 0.40
R7979:Nars2 UTSW 7 97062661 missense probably damaging 1.00
R8284:Nars2 UTSW 7 96951638 utr 5 prime probably benign
R8885:Nars2 UTSW 7 97002888 missense probably damaging 0.98
R9614:Nars2 UTSW 7 97039918 missense probably damaging 0.99
R9658:Nars2 UTSW 7 97039971 missense probably benign 0.00
Z1176:Nars2 UTSW 7 96951897 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAGCAAATTGTTAACTCTCCTTGTTCC -3'
(R):5'- GCTCTAAGTGCCATCCTCAC -3'

Sequencing Primer
(F):5'- CCTTGTTCCCTTTTTAAAATTGAAGG -3'
(R):5'- TCTAAGTGCCATCCTCACAACAG -3'
Posted On 2015-05-15