Mutagenetix > Incidental Mutations

Incidental Mutation 'R4076:Olfr670'

316563

Institutional Source

Beutler Lab

Gene Symbol

Olfr670

Ensembl Gene

ENSMUSG00000044705

Gene Name

olfactory receptor 670

Synonyms

MOR32-8, GA_x6K02T2PBJ9-7589577-7588639

MMRRC Submission

040975-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R4076 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104957114-104962620 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104960716 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 5 (N5K)

Ref Sequence

ENSEMBL: ENSMUSP00000151138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050482] [ENSMUST00000214216]

Predicted Effect

probably damaging
Transcript: ENSMUST00000050482
AA Change: N5K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000060289
Gene: ENSMUSG00000044705
AA Change: N5K

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	311	3.7e-121	PFAM
Pfam:7TM_GPCR_Srsx	37	211	4.5e-7	PFAM
Pfam:7tm_1	43	293	3.9e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214216
AA Change: N5K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Anxa5	T	C	3: 36,450,380	I277V	probably benign	Het
Atg12	A	G	18: 46,737,424	F92L	probably benign	Het
Cd48	T	A	1: 171,695,883	V98D	probably damaging	Het
Dnah11	A	G	12: 118,045,678	M2083T	probably benign	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Dnali1	T	C	4: 125,059,470	D188G	probably damaging	Het
Dst	A	G	1: 34,192,269	E2656G	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Fras1	G	C	5: 96,743,158	D2849H	probably damaging	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hdc	C	T	2: 126,616,261	R47Q	possibly damaging	Het
Ighv1-30	C	T	12: 114,817,401		noncoding transcript	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Ltb4r2	A	T	14: 55,762,941	R340W	probably benign	Het
Map10	T	C	8: 125,671,845	V659A	probably benign	Het
Nars2	T	A	7: 96,958,094	S91T	probably damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Osgin1	A	C	8: 119,445,033	S189R	possibly damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pik3c2g	A	T	6: 139,852,863	N373I	probably damaging	Het
Pou2f2	T	C	7: 25,097,288	T270A	probably damaging	Het
Rad51b	T	G	12: 79,314,882	S122R	probably damaging	Het
Rev1	T	G	1: 38,054,238	K1075T	possibly damaging	Het
Rrbp1	T	G	2: 143,963,110	Q1045P	probably benign	Het
Scg2	A	C	1: 79,436,857	F50V	probably damaging	Het
Slco1a5	A	T	6: 142,268,224	I57K	possibly damaging	Het
Tfb1m	T	A	17: 3,521,670	R257W	probably damaging	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het
Zfp608	A	T	18: 54,898,108	V920E	probably damaging	Het

Other mutations in Olfr670

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Olfr670	APN	7	104960716	missense	probably damaging	0.96
IGL01100:Olfr670	APN	7	104959995	missense	probably benign	0.07
IGL01351:Olfr670	APN	7	104960739	start gained	probably benign
IGL01478:Olfr670	APN	7	104960348	missense	probably damaging	0.97
IGL01835:Olfr670	APN	7	104960462	missense	probably benign	0.01
IGL02326:Olfr670	APN	7	104960646	missense	probably benign	0.12
IGL02434:Olfr670	APN	7	104960072	missense	probably benign	0.05
IGL02434:Olfr670	APN	7	104960074	nonsense	probably null
IGL02968:Olfr670	APN	7	104960244	missense	possibly damaging	0.90
R0055:Olfr670	UTSW	7	104960496	missense	possibly damaging	0.46
R0055:Olfr670	UTSW	7	104960496	missense	possibly damaging	0.46
R0345:Olfr670	UTSW	7	104960181	missense	probably damaging	1.00
R0401:Olfr670	UTSW	7	104959943	missense	probably damaging	1.00
R0646:Olfr670	UTSW	7	104959811	missense	probably benign	0.02
R1493:Olfr670	UTSW	7	104960502	missense	probably damaging	0.97
R1532:Olfr670	UTSW	7	104960265	missense	probably benign
R1557:Olfr670	UTSW	7	104960540	missense	probably damaging	0.99
R4072:Olfr670	UTSW	7	104960716	missense	probably damaging	0.96
R4074:Olfr670	UTSW	7	104960716	missense	probably damaging	0.96
R4075:Olfr670	UTSW	7	104960716	missense	probably damaging	0.96
R4229:Olfr670	UTSW	7	104960594	missense	probably benign	0.18
R4230:Olfr670	UTSW	7	104960594	missense	probably benign	0.18
R5374:Olfr670	UTSW	7	104959996	missense	probably damaging	1.00
R6006:Olfr670	UTSW	7	104960663	missense	probably damaging	0.99
R6891:Olfr670	UTSW	7	104959985	missense	probably damaging	1.00
R7465:Olfr670	UTSW	7	104959917	missense	probably benign	0.23
R8105:Olfr670	UTSW	7	104960422	missense	probably benign	0.15
R8117:Olfr670	UTSW	7	104960149	missense	probably damaging	1.00
R8356:Olfr670	UTSW	7	104960727	missense	probably benign	0.00
R8510:Olfr670	UTSW	7	104960114	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCCCAGCATTGCTAAGAAG -3'
(R):5'- CTGCAGCTTATCTAGTGTTCACAG -3'

Sequencing Primer
(F):5'- CCAGCATTGCTAAGAAGTAAAACATG -3'
(R):5'- GAGCATTTGACTAGCACATGC -3'

Posted On

2015-05-15