Incidental Mutation 'R4076:Olfr670'
ID316563
Institutional Source Beutler Lab
Gene Symbol Olfr670
Ensembl Gene ENSMUSG00000044705
Gene Nameolfactory receptor 670
SynonymsMOR32-8, GA_x6K02T2PBJ9-7589577-7588639
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4076 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104957114-104962620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104960716 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 5 (N5K)
Ref Sequence ENSEMBL: ENSMUSP00000151138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050482] [ENSMUST00000214216]
Predicted Effect probably damaging
Transcript: ENSMUST00000050482
AA Change: N5K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060289
Gene: ENSMUSG00000044705
AA Change: N5K

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 3.7e-121 PFAM
Pfam:7TM_GPCR_Srsx 37 211 4.5e-7 PFAM
Pfam:7tm_1 43 293 3.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214216
AA Change: N5K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Olfr670
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Olfr670 APN 7 104960716 missense probably damaging 0.96
IGL01100:Olfr670 APN 7 104959995 missense probably benign 0.07
IGL01351:Olfr670 APN 7 104960739 start gained probably benign
IGL01478:Olfr670 APN 7 104960348 missense probably damaging 0.97
IGL01835:Olfr670 APN 7 104960462 missense probably benign 0.01
IGL02326:Olfr670 APN 7 104960646 missense probably benign 0.12
IGL02434:Olfr670 APN 7 104960072 missense probably benign 0.05
IGL02434:Olfr670 APN 7 104960074 nonsense probably null
IGL02968:Olfr670 APN 7 104960244 missense possibly damaging 0.90
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0345:Olfr670 UTSW 7 104960181 missense probably damaging 1.00
R0401:Olfr670 UTSW 7 104959943 missense probably damaging 1.00
R0646:Olfr670 UTSW 7 104959811 missense probably benign 0.02
R1493:Olfr670 UTSW 7 104960502 missense probably damaging 0.97
R1532:Olfr670 UTSW 7 104960265 missense probably benign
R1557:Olfr670 UTSW 7 104960540 missense probably damaging 0.99
R4072:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4074:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4075:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4229:Olfr670 UTSW 7 104960594 missense probably benign 0.18
R4230:Olfr670 UTSW 7 104960594 missense probably benign 0.18
R5374:Olfr670 UTSW 7 104959996 missense probably damaging 1.00
R6006:Olfr670 UTSW 7 104960663 missense probably damaging 0.99
R6891:Olfr670 UTSW 7 104959985 missense probably damaging 1.00
R7465:Olfr670 UTSW 7 104959917 missense probably benign 0.23
R8105:Olfr670 UTSW 7 104960422 missense probably benign 0.15
R8117:Olfr670 UTSW 7 104960149 missense probably damaging 1.00
R8356:Olfr670 UTSW 7 104960727 missense probably benign 0.00
R8510:Olfr670 UTSW 7 104960114 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCCAGCATTGCTAAGAAG -3'
(R):5'- CTGCAGCTTATCTAGTGTTCACAG -3'

Sequencing Primer
(F):5'- CCAGCATTGCTAAGAAGTAAAACATG -3'
(R):5'- GAGCATTTGACTAGCACATGC -3'
Posted On2015-05-15