Incidental Mutation 'R4076:Acsm4'
ID 316564
Institutional Source Beutler Lab
Gene Symbol Acsm4
Ensembl Gene ENSMUSG00000047026
Gene Name acyl-CoA synthetase medium-chain family member 4
Synonyms OMACS, O-MACS
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 119690026-119714565 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119698758 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 206 (L206H)
Ref Sequence ENSEMBL: ENSMUSP00000045160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047045]
AlphaFold Q80W40
Predicted Effect probably benign
Transcript: ENSMUST00000047045
AA Change: L206H

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045160
Gene: ENSMUSG00000047026
AA Change: L206H

DomainStartEndE-ValueType
Pfam:AMP-binding 64 478 5.8e-83 PFAM
Pfam:AMP-binding_C 486 566 1.4e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Acsm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Acsm4 APN 7 119711419 nonsense probably null
IGL01676:Acsm4 APN 7 119708643 missense probably benign 0.00
IGL01801:Acsm4 APN 7 119707263 missense possibly damaging 0.80
IGL02183:Acsm4 APN 7 119693852 splice site probably null
IGL02220:Acsm4 APN 7 119711172 missense probably damaging 1.00
IGL02637:Acsm4 APN 7 119710684 missense probably damaging 1.00
IGL03290:Acsm4 APN 7 119703423 splice site probably benign
I0000:Acsm4 UTSW 7 119711192 missense probably damaging 1.00
PIT4382001:Acsm4 UTSW 7 119698575 missense probably damaging 1.00
R1068:Acsm4 UTSW 7 119708710 missense probably benign 0.00
R1386:Acsm4 UTSW 7 119698578 missense probably benign
R1433:Acsm4 UTSW 7 119693819 missense probably damaging 0.99
R1961:Acsm4 UTSW 7 119708740 missense probably benign 0.04
R3957:Acsm4 UTSW 7 119703365 missense possibly damaging 0.93
R4029:Acsm4 UTSW 7 119693785 missense probably benign
R4072:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4075:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4432:Acsm4 UTSW 7 119711387 missense probably damaging 1.00
R4452:Acsm4 UTSW 7 119698574 missense possibly damaging 0.92
R4757:Acsm4 UTSW 7 119698677 missense probably benign
R4992:Acsm4 UTSW 7 119711417 missense probably benign 0.43
R5046:Acsm4 UTSW 7 119703374 missense probably damaging 0.99
R5473:Acsm4 UTSW 7 119712950 missense probably damaging 1.00
R5662:Acsm4 UTSW 7 119694800 missense possibly damaging 0.49
R5780:Acsm4 UTSW 7 119693845 missense possibly damaging 0.66
R6957:Acsm4 UTSW 7 119711399 missense probably damaging 1.00
R7579:Acsm4 UTSW 7 119693710 missense probably benign 0.01
R7892:Acsm4 UTSW 7 119694666 missense possibly damaging 0.48
R8716:Acsm4 UTSW 7 119708660 missense probably damaging 1.00
R8738:Acsm4 UTSW 7 119705041 missense probably benign 0.00
R9616:Acsm4 UTSW 7 119694649 missense probably benign 0.01
Z1177:Acsm4 UTSW 7 119711371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACGATCCAACTGACCAG -3'
(R):5'- CACTCATCATAGGCCACAGAGG -3'

Sequencing Primer
(F):5'- GAAAAGACATCCTCTACCGGCTG -3'
(R):5'- CAGAGGACATATGTTCAATCCCTGG -3'
Posted On 2015-05-15