Mutagenetix > Incidental Mutation

Incidental Mutation 'R4076:Usp31'

316565

Institutional Source

Beutler Lab

Gene Symbol

Usp31

Ensembl Gene

ENSMUSG00000063317

Gene Name

ubiquitin specific peptidase 31

Synonyms

MMRRC Submission

040975-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R4076 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121642021-121707253 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 121667782 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000040037 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046929]

AlphaFold

E9Q6Y8

Predicted Effect

probably null
Transcript: ENSMUST00000046929

SMART Domains

Protein: ENSMUSP00000040037
Gene: ENSMUSG00000063317

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
low complexity region	29	58	N/A	INTRINSIC
low complexity region	64	75	N/A	INTRINSIC
low complexity region	90	120	N/A	INTRINSIC
Pfam:UCH	122	755	2.5e-64	PFAM
Pfam:UCH_1	562	737	1.3e-12	PFAM
low complexity region	763	777	N/A	INTRINSIC
low complexity region	792	811	N/A	INTRINSIC
low complexity region	831	847	N/A	INTRINSIC
low complexity region	869	881	N/A	INTRINSIC
low complexity region	985	996	N/A	INTRINSIC
low complexity region	1009	1030	N/A	INTRINSIC
low complexity region	1044	1060	N/A	INTRINSIC
low complexity region	1072	1127	N/A	INTRINSIC
low complexity region	1161	1173	N/A	INTRINSIC
low complexity region	1192	1204	N/A	INTRINSIC
low complexity region	1245	1258	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205473

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Anxa5	T	C	3: 36,450,380	I277V	probably benign	Het
Atg12	A	G	18: 46,737,424	F92L	probably benign	Het
Cd48	T	A	1: 171,695,883	V98D	probably damaging	Het
Dnah11	A	G	12: 118,045,678	M2083T	probably benign	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Dnali1	T	C	4: 125,059,470	D188G	probably damaging	Het
Dst	A	G	1: 34,192,269	E2656G	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Fras1	G	C	5: 96,743,158	D2849H	probably damaging	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hdc	C	T	2: 126,616,261	R47Q	possibly damaging	Het
Ighv1-30	C	T	12: 114,817,401		noncoding transcript	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Ltb4r2	A	T	14: 55,762,941	R340W	probably benign	Het
Map10	T	C	8: 125,671,845	V659A	probably benign	Het
Nars2	T	A	7: 96,958,094	S91T	probably damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Osgin1	A	C	8: 119,445,033	S189R	possibly damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pik3c2g	A	T	6: 139,852,863	N373I	probably damaging	Het
Pou2f2	T	C	7: 25,097,288	T270A	probably damaging	Het
Rad51b	T	G	12: 79,314,882	S122R	probably damaging	Het
Rev1	T	G	1: 38,054,238	K1075T	possibly damaging	Het
Rrbp1	T	G	2: 143,963,110	Q1045P	probably benign	Het
Scg2	A	C	1: 79,436,857	F50V	probably damaging	Het
Slco1a5	A	T	6: 142,268,224	I57K	possibly damaging	Het
Tfb1m	T	A	17: 3,521,670	R257W	probably damaging	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het
Zfp608	A	T	18: 54,898,108	V920E	probably damaging	Het

Other mutations in Usp31

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Usp31	APN	7	121706670	missense	probably damaging	1.00
IGL00421:Usp31	APN	7	121648650	missense	probably damaging	0.96
IGL00657:Usp31	APN	7	121648231	missense	probably benign	0.00
IGL01917:Usp31	APN	7	121679485	missense	probably benign	0.26
IGL02444:Usp31	APN	7	121679495	missense	probably damaging	1.00
IGL03090:Usp31	APN	7	121679530	splice site	probably benign
R0334:Usp31	UTSW	7	121658962	missense	probably damaging	0.99
R0945:Usp31	UTSW	7	121670253	missense	probably damaging	1.00
R1326:Usp31	UTSW	7	121648302	missense	probably damaging	1.00
R2116:Usp31	UTSW	7	121648696	missense	probably benign	0.39
R3113:Usp31	UTSW	7	121679513	missense	probably damaging	1.00
R4072:Usp31	UTSW	7	121667782	splice site	probably null
R4075:Usp31	UTSW	7	121667782	splice site	probably null
R4306:Usp31	UTSW	7	121706929	missense	possibly damaging	0.93
R4675:Usp31	UTSW	7	121707325	unclassified	probably benign
R4960:Usp31	UTSW	7	121648645	missense	probably damaging	0.99
R5368:Usp31	UTSW	7	121661365	missense	probably damaging	1.00
R5396:Usp31	UTSW	7	121667782	splice site	probably null
R5456:Usp31	UTSW	7	121670277	missense	probably damaging	1.00
R5475:Usp31	UTSW	7	121651526	missense	probably damaging	1.00
R5497:Usp31	UTSW	7	121651601	missense	probably damaging	1.00
R5872:Usp31	UTSW	7	121649475	missense	probably benign	0.05
R6301:Usp31	UTSW	7	121648276	missense	possibly damaging	0.76
R6688:Usp31	UTSW	7	121678330	missense	probably benign	0.01
R6875:Usp31	UTSW	7	121649640	nonsense	probably null
R6895:Usp31	UTSW	7	121653176	missense	probably benign	0.00
R7570:Usp31	UTSW	7	121674963	missense	probably damaging	1.00
R7633:Usp31	UTSW	7	121658962	missense	probably damaging	0.99
R7666:Usp31	UTSW	7	121649181	missense	possibly damaging	0.68
R7841:Usp31	UTSW	7	121648456	missense	probably benign	0.00
R7841:Usp31	UTSW	7	121677312	missense	probably damaging	0.96
R8013:Usp31	UTSW	7	121649257	missense	probably damaging	0.99
R8014:Usp31	UTSW	7	121649257	missense	probably damaging	0.99
R8118:Usp31	UTSW	7	121677262	missense	probably damaging	1.00
R8140:Usp31	UTSW	7	121649026	missense	possibly damaging	0.79
R9063:Usp31	UTSW	7	121707243	missense	probably benign
R9795:Usp31	UTSW	7	121648276	missense	probably benign	0.00
X0062:Usp31	UTSW	7	121651514	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TGAGCCTTGGACAGAAGTTGG -3'
(R):5'- CTCATTAAAGACTTTCTGATGGGGAAC -3'

Sequencing Primer
(F):5'- GGGGAAAGAATAATAAACTCCTTCAG -3'
(R):5'- CTGATGGGGAACTATAAAGATTTCCC -3'

Posted On

2015-05-15