Mutagenetix > Incidental Mutation

Incidental Mutation 'R4076:Gm5346'

316567

Institutional Source

Beutler Lab

Gene Symbol

Gm5346

Ensembl Gene

ENSMUSG00000050190

Gene Name

predicted gene 5346

Synonyms

MMRRC Submission

040975-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R4076 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43624951-43627276 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43626350 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 279 (F279Y)

Ref Sequence

ENSEMBL: ENSMUSP00000058858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056023]

AlphaFold

Q7M766

Predicted Effect

probably damaging
Transcript: ENSMUST00000056023
AA Change: F279Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: F279Y

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Pfam:Pep_M12B_propep	39	159	1.3e-18	PFAM
Pfam:Reprolysin_5	205	384	1.1e-15	PFAM
Pfam:Reprolysin_4	205	393	6.2e-9	PFAM
Pfam:Reprolysin	207	397	1.7e-46	PFAM
Pfam:Reprolysin_2	223	389	5.7e-14	PFAM
Pfam:Reprolysin_3	231	352	2.6e-13	PFAM
DISIN	416	491	2.48e-38	SMART
ACR	492	628	3.4e-65	SMART
EGF	634	664	2.69e1	SMART
transmembrane domain	685	707	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Anxa5	T	C	3: 36,450,380	I277V	probably benign	Het
Atg12	A	G	18: 46,737,424	F92L	probably benign	Het
Cd48	T	A	1: 171,695,883	V98D	probably damaging	Het
Dnah11	A	G	12: 118,045,678	M2083T	probably benign	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Dnali1	T	C	4: 125,059,470	D188G	probably damaging	Het
Dst	A	G	1: 34,192,269	E2656G	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Fras1	G	C	5: 96,743,158	D2849H	probably damaging	Het
Hdc	C	T	2: 126,616,261	R47Q	possibly damaging	Het
Ighv1-30	C	T	12: 114,817,401		noncoding transcript	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Ltb4r2	A	T	14: 55,762,941	R340W	probably benign	Het
Map10	T	C	8: 125,671,845	V659A	probably benign	Het
Nars2	T	A	7: 96,958,094	S91T	probably damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Osgin1	A	C	8: 119,445,033	S189R	possibly damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pik3c2g	A	T	6: 139,852,863	N373I	probably damaging	Het
Pou2f2	T	C	7: 25,097,288	T270A	probably damaging	Het
Rad51b	T	G	12: 79,314,882	S122R	probably damaging	Het
Rev1	T	G	1: 38,054,238	K1075T	possibly damaging	Het
Rrbp1	T	G	2: 143,963,110	Q1045P	probably benign	Het
Scg2	A	C	1: 79,436,857	F50V	probably damaging	Het
Slco1a5	A	T	6: 142,268,224	I57K	possibly damaging	Het
Tfb1m	T	A	17: 3,521,670	R257W	probably damaging	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het
Zfp608	A	T	18: 54,898,108	V920E	probably damaging	Het

Other mutations in Gm5346

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Gm5346	APN	8	43625381	missense	probably benign	0.12
IGL00391:Gm5346	APN	8	43625629	missense	probably damaging	1.00
IGL00422:Gm5346	APN	8	43626351	missense	probably damaging	1.00
IGL00664:Gm5346	APN	8	43625969	missense	probably benign
IGL01095:Gm5346	APN	8	43626096	missense	probably benign	0.22
IGL01113:Gm5346	APN	8	43626152	missense	probably damaging	1.00
IGL01444:Gm5346	APN	8	43626433	missense	probably benign	0.06
IGL01782:Gm5346	APN	8	43626735	missense	probably benign	0.01
IGL01921:Gm5346	APN	8	43625511	missense	probably damaging	0.96
IGL01964:Gm5346	APN	8	43626761	missense	probably benign	0.00
IGL02139:Gm5346	APN	8	43625578	missense	probably benign	0.01
IGL02555:Gm5346	APN	8	43625268	missense	probably damaging	1.00
IGL02951:Gm5346	APN	8	43627088	missense	possibly damaging	0.62
R0056:Gm5346	UTSW	8	43625503	nonsense	probably null
R0218:Gm5346	UTSW	8	43626440	missense	probably benign	0.00
R0530:Gm5346	UTSW	8	43626531	missense	probably benign	0.00
R0925:Gm5346	UTSW	8	43626303	missense	probably benign	0.11
R0927:Gm5346	UTSW	8	43625123	missense	probably benign	0.00
R0975:Gm5346	UTSW	8	43625118	missense	probably benign
R1300:Gm5346	UTSW	8	43626844	nonsense	probably null
R1728:Gm5346	UTSW	8	43625583	missense	probably damaging	1.00
R1729:Gm5346	UTSW	8	43625583	missense	probably damaging	1.00
R1801:Gm5346	UTSW	8	43625917	nonsense	probably null
R1869:Gm5346	UTSW	8	43625095	nonsense	probably null
R1870:Gm5346	UTSW	8	43625095	nonsense	probably null
R1871:Gm5346	UTSW	8	43625095	nonsense	probably null
R1992:Gm5346	UTSW	8	43627139	missense	probably benign	0.44
R2008:Gm5346	UTSW	8	43627037	missense	probably benign	0.00
R2013:Gm5346	UTSW	8	43626405	missense	possibly damaging	0.81
R2022:Gm5346	UTSW	8	43625917	nonsense	probably null
R2175:Gm5346	UTSW	8	43625438	missense	probably benign
R2875:Gm5346	UTSW	8	43627140	nonsense	probably null
R3406:Gm5346	UTSW	8	43626052	nonsense	probably null
R3845:Gm5346	UTSW	8	43626632	missense	probably benign	0.00
R4033:Gm5346	UTSW	8	43626673	missense	probably benign	0.28
R4072:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4074:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4075:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4153:Gm5346	UTSW	8	43626527	missense	probably benign	0.04
R4330:Gm5346	UTSW	8	43626250	missense	probably benign
R4612:Gm5346	UTSW	8	43626550	missense	probably benign	0.09
R4662:Gm5346	UTSW	8	43627079	missense	probably benign	0.26
R5032:Gm5346	UTSW	8	43626471	missense	probably damaging	1.00
R5077:Gm5346	UTSW	8	43627163	missense	possibly damaging	0.79
R5504:Gm5346	UTSW	8	43625282	missense	probably damaging	1.00
R5697:Gm5346	UTSW	8	43626579	missense	probably damaging	1.00
R6232:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6233:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6234:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6235:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6241:Gm5346	UTSW	8	43626096	missense	probably benign	0.22
R6392:Gm5346	UTSW	8	43626001	missense	probably benign	0.09
R6439:Gm5346	UTSW	8	43625951	missense	probably damaging	1.00
R6454:Gm5346	UTSW	8	43626808	missense	probably damaging	0.96
R6455:Gm5346	UTSW	8	43626152	missense	probably damaging	1.00
R6767:Gm5346	UTSW	8	43626914	missense	probably damaging	1.00
R6774:Gm5346	UTSW	8	43625183	missense	probably benign	0.00
R6877:Gm5346	UTSW	8	43625237	missense	probably benign	0.02
R6911:Gm5346	UTSW	8	43625109	missense	probably benign	0.02
R7211:Gm5346	UTSW	8	43625877	missense	probably damaging	1.00
R7597:Gm5346	UTSW	8	43625244	missense	probably damaging	1.00
R7602:Gm5346	UTSW	8	43626666	missense	probably damaging	0.99
R7797:Gm5346	UTSW	8	43626374	missense	probably benign	0.04
R7981:Gm5346	UTSW	8	43625813	missense	probably damaging	1.00
R8154:Gm5346	UTSW	8	43625387	missense	probably damaging	0.97
R8215:Gm5346	UTSW	8	43626501	missense	probably benign	0.05
R9180:Gm5346	UTSW	8	43626933	nonsense	probably null
R9307:Gm5346	UTSW	8	43626267	missense	probably benign	0.00
R9733:Gm5346	UTSW	8	43626149	missense	possibly damaging	0.94
RF001:Gm5346	UTSW	8	43626905	missense	possibly damaging	0.79
Z1177:Gm5346	UTSW	8	43626546	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTGCTACGATGAATGCCAGATATG -3'
(R):5'- ATTGGTGGACCCATCACAGG -3'

Sequencing Primer
(F):5'- TACGATGAATGCCAGATATGATAACG -3'
(R):5'- TGGACCCATCACAGGTTTATTG -3'

Posted On

2015-05-15