Incidental Mutation 'R4076:Eps15l1'
ID 316569
Institutional Source Beutler Lab
Gene Symbol Eps15l1
Ensembl Gene ENSMUSG00000006276
Gene Name epidermal growth factor receptor pathway substrate 15-like 1
Synonyms 9830147J04Rik, Eps15-rs, Eps15R
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 72340999-72421460 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72380284 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 482 (I482T)
Ref Sequence ENSEMBL: ENSMUSP00000148468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163643] [ENSMUST00000212121] [ENSMUST00000212590]
AlphaFold Q60902
Predicted Effect probably damaging
Transcript: ENSMUST00000163643
AA Change: I482T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129739
Gene: ENSMUSG00000006276
AA Change: I482T

DomainStartEndE-ValueType
EH 8 103 1.45e-21 SMART
EFh 52 80 6.56e0 SMART
EH 120 214 6.1e-47 SMART
EFh 163 191 4.35e-2 SMART
low complexity region 241 255 N/A INTRINSIC
EH 266 362 5.08e-44 SMART
EFh 276 304 1.09e0 SMART
coiled coil region 381 564 N/A INTRINSIC
internal_repeat_2 615 656 1.56e-6 PROSPERO
low complexity region 661 678 N/A INTRINSIC
low complexity region 701 722 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 746 764 N/A INTRINSIC
low complexity region 775 790 N/A INTRINSIC
internal_repeat_2 809 839 1.56e-6 PROSPERO
low complexity region 840 853 N/A INTRINSIC
UIM 863 882 3.98e1 SMART
UIM 889 907 3.76e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212121
AA Change: I482T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212590
AA Change: I482T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212950
Meta Mutation Damage Score 0.1266 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Eps15l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Eps15l1 APN 8 72384838 nonsense probably null
IGL01316:Eps15l1 APN 8 72389414 missense possibly damaging 0.66
IGL01344:Eps15l1 APN 8 72382325 critical splice donor site probably null
IGL01918:Eps15l1 APN 8 72367912 missense possibly damaging 0.49
IGL01982:Eps15l1 APN 8 72379075 missense probably benign 0.28
IGL02305:Eps15l1 APN 8 72387009 missense probably null 1.00
IGL02939:Eps15l1 APN 8 72384762 splice site probably benign
IGL02951:Eps15l1 APN 8 72358396 missense probably benign 0.19
R0025:Eps15l1 UTSW 8 72381497 splice site probably benign
R0025:Eps15l1 UTSW 8 72381497 splice site probably benign
R0030:Eps15l1 UTSW 8 72373050 missense probably benign 0.03
R0030:Eps15l1 UTSW 8 72373050 missense probably benign 0.03
R0799:Eps15l1 UTSW 8 72346085 missense probably damaging 0.99
R1300:Eps15l1 UTSW 8 72391902 missense probably damaging 0.99
R2131:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R2132:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R2133:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R3693:Eps15l1 UTSW 8 72399060 splice site probably benign
R4072:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4074:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4485:Eps15l1 UTSW 8 72399687 missense possibly damaging 0.78
R4592:Eps15l1 UTSW 8 72341394 missense probably damaging 0.96
R4606:Eps15l1 UTSW 8 72373916 missense possibly damaging 0.69
R4981:Eps15l1 UTSW 8 72378989 critical splice donor site probably null
R5496:Eps15l1 UTSW 8 72382775 missense probably benign 0.00
R5502:Eps15l1 UTSW 8 72378992 splice site probably null
R5682:Eps15l1 UTSW 8 72371748 nonsense probably null
R6326:Eps15l1 UTSW 8 72341434 nonsense probably null
R6384:Eps15l1 UTSW 8 72368710 critical splice donor site probably null
R7305:Eps15l1 UTSW 8 72373034 missense probably benign
R7500:Eps15l1 UTSW 8 72382790 missense probably damaging 1.00
R7732:Eps15l1 UTSW 8 72380976 missense probably damaging 1.00
R8980:Eps15l1 UTSW 8 72373890 missense probably benign 0.00
R9065:Eps15l1 UTSW 8 72391918 nonsense probably null
R9238:Eps15l1 UTSW 8 72341430 missense probably damaging 1.00
Z1088:Eps15l1 UTSW 8 72386901 missense probably damaging 0.99
Z1177:Eps15l1 UTSW 8 72373078 critical splice acceptor site probably null
Z1177:Eps15l1 UTSW 8 72381437 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GATGTCATCCTGTGTGCACTTC -3'
(R):5'- CTGGCTATGCAGACTCCTTATGC -3'

Sequencing Primer
(F):5'- ATCCTGTGTGCACTTCAGGGAC -3'
(R):5'- CTATGCAGACTCCTTATGCTTTATAC -3'
Posted On 2015-05-15