Incidental Mutation 'R4076:Map10'
ID316571
Institutional Source Beutler Lab
Gene Symbol Map10
Ensembl Gene ENSMUSG00000050930
Gene Namemicrotubule-associated protein 10
Synonyms4933403G14Rik
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4076 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125669818-125673359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125671845 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 659 (V659A)
Ref Sequence ENSEMBL: ENSMUSP00000061679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053078]
Predicted Effect probably benign
Transcript: ENSMUST00000053078
AA Change: V659A

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061679
Gene: ENSMUSG00000050930
AA Change: V659A

DomainStartEndE-ValueType
low complexity region 38 54 N/A INTRINSIC
low complexity region 68 91 N/A INTRINSIC
Pfam:HPHLAWLY 243 535 1.4e-130 PFAM
Pfam:HPHLAWLY 527 890 9.1e-133 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Map10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Map10 APN 8 125671932 missense probably benign 0.00
IGL01567:Map10 APN 8 125671493 missense probably benign 0.32
IGL02566:Map10 APN 8 125671755 missense probably benign
IGL03088:Map10 APN 8 125671070 missense probably benign 0.14
debauched UTSW 8 125671245 missense probably damaging 1.00
R1083:Map10 UTSW 8 125670439 nonsense probably null
R1543:Map10 UTSW 8 125670872 missense probably benign 0.00
R3155:Map10 UTSW 8 125671574 missense possibly damaging 0.79
R4559:Map10 UTSW 8 125671814 missense probably benign
R4856:Map10 UTSW 8 125670692 missense probably damaging 1.00
R4886:Map10 UTSW 8 125670692 missense probably damaging 1.00
R5412:Map10 UTSW 8 125670985 missense probably damaging 1.00
R6034:Map10 UTSW 8 125672466 missense probably damaging 1.00
R6034:Map10 UTSW 8 125672466 missense probably damaging 1.00
R6150:Map10 UTSW 8 125671589 missense probably damaging 0.96
R6351:Map10 UTSW 8 125671245 missense probably damaging 1.00
R6466:Map10 UTSW 8 125672384 nonsense probably null
R6544:Map10 UTSW 8 125671374 missense probably benign 0.00
R6557:Map10 UTSW 8 125670252 missense probably damaging 0.98
R6821:Map10 UTSW 8 125670399 missense probably benign 0.01
R7096:Map10 UTSW 8 125671923 missense probably damaging 0.99
R7128:Map10 UTSW 8 125671853 missense probably benign
R7177:Map10 UTSW 8 125671845 missense probably benign 0.23
R7237:Map10 UTSW 8 125671224 missense probably benign 0.03
R7814:Map10 UTSW 8 125671611 missense probably benign 0.14
R7819:Map10 UTSW 8 125670521 frame shift probably null
Z1088:Map10 UTSW 8 125671931 frame shift probably null
Z1177:Map10 UTSW 8 125670070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAACCATTGTCACTGCTCTG -3'
(R):5'- TGACTTGCTTGCCCGTGAAC -3'

Sequencing Primer
(F):5'- TCTGAGAGCACCCGTGAG -3'
(R):5'- CGTGAACCCTTTTGCACATG -3'
Posted On2015-05-15