Incidental Mutation 'R4076:Krtap31-1'
ID 316573
Institutional Source Beutler Lab
Gene Symbol Krtap31-1
Ensembl Gene ENSMUSG00000070334
Gene Name keratin associated protein 31-1
Synonyms
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R4076 (G1)
Quality Score 186
Status Not validated
Chromosome 11
Chromosomal Location 99907920-99908892 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99908232 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 87 (I87T)
Ref Sequence ENSEMBL: ENSMUSP00000091467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093935]
AlphaFold Q9D644
Predicted Effect possibly damaging
Transcript: ENSMUST00000093935
AA Change: I87T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091467
Gene: ENSMUSG00000070334
AA Change: I87T

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 40 56 N/A INTRINSIC
Pfam:Keratin_B2_2 64 107 1.9e-9 PFAM
Pfam:Keratin_B2_2 111 157 2.4e-6 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Krtap31-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1608:Krtap31-1 UTSW 11 99908093 missense probably benign 0.18
R2284:Krtap31-1 UTSW 11 99908255 nonsense probably null
R2343:Krtap31-1 UTSW 11 99908021 missense possibly damaging 0.86
R4072:Krtap31-1 UTSW 11 99908232 missense possibly damaging 0.52
R4074:Krtap31-1 UTSW 11 99908232 missense possibly damaging 0.52
R4086:Krtap31-1 UTSW 11 99908319 missense possibly damaging 0.93
R4884:Krtap31-1 UTSW 11 99908484 missense unknown
R7644:Krtap31-1 UTSW 11 99908222 missense possibly damaging 0.71
R7670:Krtap31-1 UTSW 11 99908432 missense not run
R7897:Krtap31-1 UTSW 11 99908123 missense possibly damaging 0.73
R7949:Krtap31-1 UTSW 11 99908318 missense possibly damaging 0.71
R8158:Krtap31-1 UTSW 11 99908075 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AATCCAGCTCTGAATCCAGC -3'
(R):5'- TGGTTATCAGCGGCAGATG -3'

Sequencing Primer
(F):5'- TGAATCCAGCTGCCCTGTG -3'
(R):5'- TATCAGCGGCAGATGGGCAC -3'
Posted On 2015-05-15