Incidental Mutation 'R4076:Rad51b'
ID 316575
Institutional Source Beutler Lab
Gene Symbol Rad51b
Ensembl Gene ENSMUSG00000059060
Gene Name RAD51 paralog B
Synonyms mREC2, R51H2, Rad51b
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 79297282-79814690 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 79314882 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 122 (S122R)
Ref Sequence ENSEMBL: ENSMUSP00000152105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079533] [ENSMUST00000171210] [ENSMUST00000218039]
AlphaFold O35719
Predicted Effect probably damaging
Transcript: ENSMUST00000079533
AA Change: S122R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078490
Gene: ENSMUSG00000059060
AA Change: S122R

DomainStartEndE-ValueType
Pfam:Rad51 61 256 3.1e-32 PFAM
Pfam:AAA_25 68 249 1.1e-15 PFAM
Pfam:KaiC 83 240 1.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171210
AA Change: S122R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128357
Gene: ENSMUSG00000059060
AA Change: S122R

DomainStartEndE-ValueType
Pfam:Rad51 61 256 3e-33 PFAM
Pfam:AAA_25 68 241 2.8e-16 PFAM
Pfam:KaiC 83 241 3.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218039
AA Change: S122R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are evolutionarily conserved proteins essential for DNA repair by homologous recombination. This protein has been shown to form a stable heterodimer with the family member RAD51C, which further interacts with the other family members, such as RAD51, XRCC2, and XRCC3. Overexpression of this gene was found to cause cell cycle G1 delay and cell apoptosis, which suggested a role of this protein in sensing DNA damage. Rearrangements between this locus and high mobility group AT-hook 2 (HMGA2, GeneID 8091) have been observed in uterine leiomyomata. [provided by RefSeq, Mar 2016]
PHENOTYPE: Embryos homozygous for a knock-out allele are severely growth retarded and exhibit complete early embryonic lethality; interestingly, mutant embryos survive and develop further in a Trp53-null background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Rad51b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Rad51b APN 12 79302553 missense probably benign 0.00
IGL01599:Rad51b APN 12 79327228 missense probably benign 0.30
IGL02955:Rad51b APN 12 79325082 nonsense probably null
R1544:Rad51b UTSW 12 79302543 missense possibly damaging 0.87
R2998:Rad51b UTSW 12 79302489 missense probably damaging 1.00
R3784:Rad51b UTSW 12 79300645 nonsense probably null
R5916:Rad51b UTSW 12 79325082 nonsense probably null
R7489:Rad51b UTSW 12 79300585 nonsense probably null
R7765:Rad51b UTSW 12 79803270 critical splice donor site probably null
R8160:Rad51b UTSW 12 79303341 missense probably benign 0.00
R8206:Rad51b UTSW 12 79314941 missense probably damaging 1.00
R8489:Rad51b UTSW 12 79327250 missense probably benign 0.08
R8977:Rad51b UTSW 12 79657888 missense probably damaging 1.00
R9015:Rad51b UTSW 12 79300643 missense probably damaging 1.00
R9073:Rad51b UTSW 12 79297665 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGCCATTTGTCAACAGGAGAAC -3'
(R):5'- ACCAGTACCTAGCATCCTTTG -3'

Sequencing Primer
(F):5'- GAAAAGTTAGCATGCTACCTGC -3'
(R):5'- ACCTAGCATCCTTTGTCCTTAAAAG -3'
Posted On 2015-05-15