Incidental Mutation 'R4076:Ltb4r2'
ID 316577
Institutional Source Beutler Lab
Gene Symbol Ltb4r2
Ensembl Gene ENSMUSG00000040432
Gene Name leukotriene B4 receptor 2
Synonyms BLT2, 5830462O07Rik
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 55761428-55765138 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55762941 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 340 (R340W)
Ref Sequence ENSEMBL: ENSMUSP00000048358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001497] [ENSMUST00000044554] [ENSMUST00000057569]
AlphaFold Q9JJL9
Predicted Effect probably benign
Transcript: ENSMUST00000001497
SMART Domains Protein: ENSMUSP00000001497
Gene: ENSMUSG00000022219

DomainStartEndE-ValueType
CAD 36 108 2.16e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044554
AA Change: R340W

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048358
Gene: ENSMUSG00000040432
AA Change: R340W

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
Pfam:7tm_1 37 288 5.7e-31 PFAM
low complexity region 309 323 N/A INTRINSIC
low complexity region 337 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057569
SMART Domains Protein: ENSMUSP00000051368
Gene: ENSMUSG00000046908

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 28 196 7.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 31 249 2e-8 PFAM
Pfam:7tm_1 37 285 1.3e-42 PFAM
Pfam:Serpentine_r_xa 54 201 2.8e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228302
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced incidence and severity of autoantibody-induced inflammatory arthritis and decreased susceptibility to IgE antigen-dependent passive cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Ltb4r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03228:Ltb4r2 APN 14 55761951 missense probably damaging 1.00
R2077:Ltb4r2 UTSW 14 55761987 missense probably damaging 1.00
R6221:Ltb4r2 UTSW 14 55762083 missense probably damaging 1.00
R6247:Ltb4r2 UTSW 14 55762651 missense probably damaging 1.00
R6519:Ltb4r2 UTSW 14 55762981 missense probably benign
R6634:Ltb4r2 UTSW 14 55762505 splice site probably null
R6709:Ltb4r2 UTSW 14 55762533 missense possibly damaging 0.77
R7626:Ltb4r2 UTSW 14 55762881 missense probably damaging 0.99
R9302:Ltb4r2 UTSW 14 55762276 missense probably damaging 1.00
R9480:Ltb4r2 UTSW 14 55762632 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAACCCAGTGCTCTATGTC -3'
(R):5'- GTCACCCTCACAATGCCATG -3'

Sequencing Primer
(F):5'- AGTGCTCTATGTCTTCACTGCGG -3'
(R):5'- ACCCTCACAATGCCATGGTTTG -3'
Posted On 2015-05-15