Incidental Mutation 'R4076:Zfp608'
ID 316584
Institutional Source Beutler Lab
Gene Symbol Zfp608
Ensembl Gene ENSMUSG00000052713
Gene Name zinc finger protein 608
Synonyms 4932417D18Rik
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 54888045-54990180 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 54898108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 920 (V920E)
Ref Sequence ENSEMBL: ENSMUSP00000068192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064763]
AlphaFold Q56A10
Predicted Effect probably damaging
Transcript: ENSMUST00000064763
AA Change: V920E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068192
Gene: ENSMUSG00000052713
AA Change: V920E

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
low complexity region 252 266 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 459 471 N/A INTRINSIC
ZnF_C2H2 552 577 1.86e0 SMART
low complexity region 624 636 N/A INTRINSIC
low complexity region 706 718 N/A INTRINSIC
low complexity region 734 773 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 833 846 N/A INTRINSIC
low complexity region 934 956 N/A INTRINSIC
coiled coil region 1028 1054 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1255 1268 N/A INTRINSIC
low complexity region 1439 1450 N/A INTRINSIC
low complexity region 1458 1466 N/A INTRINSIC
low complexity region 1486 1502 N/A INTRINSIC
Meta Mutation Damage Score 0.2838 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Other mutations in Zfp608
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Zfp608 APN 18 54988333 missense probably benign
IGL00920:Zfp608 APN 18 54889831 missense probably benign 0.00
IGL01088:Zfp608 APN 18 54898087 missense probably benign 0.03
IGL01447:Zfp608 APN 18 54899011 missense possibly damaging 0.75
IGL01534:Zfp608 APN 18 54898932 missense probably damaging 0.99
IGL01547:Zfp608 APN 18 54894449 critical splice donor site probably null
IGL01933:Zfp608 APN 18 54987799 missense probably benign
IGL01998:Zfp608 APN 18 54891818 missense probably damaging 0.99
IGL02167:Zfp608 APN 18 54988224 missense probably damaging 1.00
IGL02266:Zfp608 APN 18 54897581 missense probably benign 0.08
IGL02335:Zfp608 APN 18 54897437 nonsense probably null
IGL02455:Zfp608 APN 18 54899333 missense probably damaging 1.00
IGL02612:Zfp608 APN 18 54898201 missense probably damaging 1.00
IGL02900:Zfp608 APN 18 54946793 missense probably damaging 1.00
PIT4243001:Zfp608 UTSW 18 54898024 missense probably damaging 1.00
PIT4519001:Zfp608 UTSW 18 54946711 missense possibly damaging 0.71
R0005:Zfp608 UTSW 18 54895520 missense possibly damaging 0.88
R0010:Zfp608 UTSW 18 54895214 splice site probably benign
R0010:Zfp608 UTSW 18 54895214 splice site probably benign
R0064:Zfp608 UTSW 18 54898816 missense probably benign
R0401:Zfp608 UTSW 18 54898994 missense probably benign
R0722:Zfp608 UTSW 18 54900234 missense probably damaging 1.00
R1351:Zfp608 UTSW 18 54898391 missense probably benign 0.00
R1512:Zfp608 UTSW 18 54946666 missense probably damaging 1.00
R1554:Zfp608 UTSW 18 54898054 missense probably damaging 1.00
R1622:Zfp608 UTSW 18 54988294 missense probably benign 0.07
R1669:Zfp608 UTSW 18 54987739 missense probably benign 0.09
R1690:Zfp608 UTSW 18 54987634 missense possibly damaging 0.62
R1721:Zfp608 UTSW 18 54899249 missense probably benign
R1826:Zfp608 UTSW 18 54898576 missense probably benign 0.03
R1864:Zfp608 UTSW 18 54897911 missense probably benign 0.00
R1952:Zfp608 UTSW 18 54897779 nonsense probably null
R2049:Zfp608 UTSW 18 54895565 missense probably damaging 1.00
R2051:Zfp608 UTSW 18 54988314 missense probably benign
R2168:Zfp608 UTSW 18 54898053 nonsense probably null
R2218:Zfp608 UTSW 18 54987684 missense probably benign 0.14
R2283:Zfp608 UTSW 18 54988374 missense probably damaging 1.00
R2399:Zfp608 UTSW 18 54897902 missense probably damaging 1.00
R2520:Zfp608 UTSW 18 54988506 missense possibly damaging 0.92
R2961:Zfp608 UTSW 18 54898472 missense possibly damaging 0.60
R4074:Zfp608 UTSW 18 54898108 missense probably damaging 1.00
R4206:Zfp608 UTSW 18 54988195 missense probably damaging 1.00
R4756:Zfp608 UTSW 18 54894472 missense probably damaging 1.00
R4771:Zfp608 UTSW 18 54988300 missense probably benign
R4820:Zfp608 UTSW 18 54987684 missense probably benign 0.14
R4825:Zfp608 UTSW 18 54897969 missense probably benign 0.01
R4912:Zfp608 UTSW 18 54946591 missense probably damaging 1.00
R4975:Zfp608 UTSW 18 54889890 missense probably damaging 1.00
R5138:Zfp608 UTSW 18 54891799 missense probably damaging 1.00
R5192:Zfp608 UTSW 18 54898497 missense probably damaging 1.00
R5557:Zfp608 UTSW 18 54987870 missense possibly damaging 0.81
R5624:Zfp608 UTSW 18 54898272 missense probably damaging 1.00
R5818:Zfp608 UTSW 18 54895396 missense probably benign 0.02
R5840:Zfp608 UTSW 18 54898906 missense probably damaging 1.00
R5992:Zfp608 UTSW 18 54899248 missense probably benign 0.15
R6106:Zfp608 UTSW 18 54987872 missense possibly damaging 0.54
R6174:Zfp608 UTSW 18 54988544 start gained probably benign
R6181:Zfp608 UTSW 18 54895628 missense possibly damaging 0.56
R6517:Zfp608 UTSW 18 54899078 missense possibly damaging 0.94
R6567:Zfp608 UTSW 18 54897556 missense probably damaging 1.00
R6668:Zfp608 UTSW 18 54898019 missense probably damaging 1.00
R6920:Zfp608 UTSW 18 54988265 missense probably damaging 1.00
R7061:Zfp608 UTSW 18 54987997 missense probably benign
R7074:Zfp608 UTSW 18 54897382 missense possibly damaging 0.69
R7087:Zfp608 UTSW 18 54899397 missense probably damaging 1.00
R7391:Zfp608 UTSW 18 54897547 missense possibly damaging 0.49
R7600:Zfp608 UTSW 18 54988020 missense probably damaging 1.00
R7723:Zfp608 UTSW 18 54897601 missense probably damaging 1.00
R8054:Zfp608 UTSW 18 54899546 missense probably benign 0.28
R8236:Zfp608 UTSW 18 54899209 missense probably damaging 1.00
R8260:Zfp608 UTSW 18 54897749 missense possibly damaging 0.60
R8732:Zfp608 UTSW 18 54988000 missense probably benign 0.06
R8781:Zfp608 UTSW 18 54898729 missense probably damaging 1.00
R8851:Zfp608 UTSW 18 54899122 missense possibly damaging 0.94
R8940:Zfp608 UTSW 18 54900229 missense possibly damaging 0.93
R9051:Zfp608 UTSW 18 54899194 missense probably damaging 1.00
R9091:Zfp608 UTSW 18 54899118 missense probably damaging 1.00
R9092:Zfp608 UTSW 18 54898576 missense probably benign 0.03
R9236:Zfp608 UTSW 18 54899282 missense probably benign 0.39
R9270:Zfp608 UTSW 18 54899118 missense probably damaging 1.00
R9283:Zfp608 UTSW 18 54897841 missense possibly damaging 0.50
R9288:Zfp608 UTSW 18 54900269 missense probably benign 0.39
R9463:Zfp608 UTSW 18 54897202 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGCCCTTTCACAACAC -3'
(R):5'- TAGCAAGGATTTGTCTGGGC -3'

Sequencing Primer
(F):5'- CCGTCTTTGTTAGAAAAGGTATCCG -3'
(R):5'- CCATCTCGGTAAGAGCGAAG -3'
Posted On 2015-05-15