Incidental Mutation 'R4076:Olfr1469'
ID316585
Institutional Source Beutler Lab
Gene Symbol Olfr1469
Ensembl Gene ENSMUSG00000063777
Gene Nameolfactory receptor 1469
SynonymsGA_x6K02T2RE5P-3743369-3744289, MOR202-11
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4076 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13407849-13414540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13410935 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 122 (R122H)
Ref Sequence ENSEMBL: ENSMUSP00000150006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077538] [ENSMUST00000216910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077538
AA Change: R122H

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076741
Gene: ENSMUSG00000063777
AA Change: R122H

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2e-47 PFAM
Pfam:7tm_1 42 290 2.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216910
AA Change: R122H

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.2696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Olfr1469
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr1469 APN 19 13411226 missense probably benign 0.01
IGL01520:Olfr1469 APN 19 13410750 missense probably damaging 0.97
IGL01671:Olfr1469 APN 19 13410891 missense probably benign 0.29
IGL02247:Olfr1469 APN 19 13411467 missense probably benign 0.01
IGL02297:Olfr1469 APN 19 13411475 missense probably benign 0.00
IGL02417:Olfr1469 APN 19 13410895 missense possibly damaging 0.52
IGL02442:Olfr1469 APN 19 13410987 missense probably benign 0.00
IGL02989:Olfr1469 APN 19 13411486 missense probably benign
IGL03269:Olfr1469 APN 19 13411428 missense probably damaging 0.99
IGL02988:Olfr1469 UTSW 19 13411462 missense possibly damaging 0.75
R0707:Olfr1469 UTSW 19 13411420 missense probably benign 0.22
R1055:Olfr1469 UTSW 19 13411390 missense probably benign 0.10
R1102:Olfr1469 UTSW 19 13411090 missense probably damaging 1.00
R1946:Olfr1469 UTSW 19 13410779 missense possibly damaging 0.64
R2111:Olfr1469 UTSW 19 13410943 missense probably damaging 0.99
R4072:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4073:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4726:Olfr1469 UTSW 19 13411105 missense probably damaging 1.00
R4939:Olfr1469 UTSW 19 13410855 missense probably benign 0.10
R5914:Olfr1469 UTSW 19 13410962 missense probably benign 0.31
R6003:Olfr1469 UTSW 19 13411039 missense probably benign 0.34
R6743:Olfr1469 UTSW 19 13410593 missense probably damaging 1.00
R6825:Olfr1469 UTSW 19 13411150 missense probably benign 0.01
R6826:Olfr1469 UTSW 19 13411088 missense probably benign 0.05
R6970:Olfr1469 UTSW 19 13411428 missense probably damaging 0.99
R7558:Olfr1469 UTSW 19 13410991 missense probably damaging 1.00
R7596:Olfr1469 UTSW 19 13411147 missense probably benign 0.01
R7923:Olfr1469 UTSW 19 13410818 missense probably benign 0.17
R8014:Olfr1469 UTSW 19 13410811 missense not run
R8506:Olfr1469 UTSW 19 13411240 missense possibly damaging 0.49
R8746:Olfr1469 UTSW 19 13410728 missense probably benign 0.44
R8803:Olfr1469 UTSW 19 13410673 missense probably damaging 0.99
Z1177:Olfr1469 UTSW 19 13410719 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCTGCTGATTGTCCTGGAC -3'
(R):5'- TCACAGAAGAAGTGATGCACTAC -3'

Sequencing Primer
(F):5'- GCTGATTGTCCTGGACTCTCG -3'
(R):5'- GTGATGCACTACATTAGACCTACAG -3'
Posted On2015-05-15