Incidental Mutation 'R4077:Zbtb41'
ID316590
Institutional Source Beutler Lab
Gene Symbol Zbtb41
Ensembl Gene ENSMUSG00000033964
Gene Namezinc finger and BTB domain containing 41
Synonyms9830132G07Rik, 8430415N23Rik
MMRRC Submission 041622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R4077 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location139422288-139453005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139429326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 440 (V440I)
Ref Sequence ENSEMBL: ENSMUSP00000142797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039867] [ENSMUST00000200243]
Predicted Effect probably benign
Transcript: ENSMUST00000039867
AA Change: V440I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045570
Gene: ENSMUSG00000033964
AA Change: V440I

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 7.06e-16 SMART
ZnF_C2H2 208 231 3.78e-1 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 4.17e-3 SMART
ZnF_C2H2 388 410 8.34e-3 SMART
ZnF_C2H2 421 444 2.67e-1 SMART
ZnF_C2H2 462 484 1.72e-4 SMART
ZnF_C2H2 490 513 1.41e0 SMART
ZnF_C2H2 517 540 1.12e-3 SMART
ZnF_C2H2 546 568 1.36e-2 SMART
ZnF_C2H2 574 596 2.91e-2 SMART
ZnF_C2H2 602 624 7.37e-4 SMART
ZnF_C2H2 630 653 3.39e-3 SMART
ZnF_C2H2 667 689 2.75e-3 SMART
ZnF_C2H2 695 717 3.16e-3 SMART
ZnF_C2H2 723 746 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199011
Predicted Effect probably benign
Transcript: ENSMUST00000200243
AA Change: V440I

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142797
Gene: ENSMUSG00000033964
AA Change: V440I

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 4.7e-18 SMART
ZnF_C2H2 208 231 1.6e-3 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 1.7e-5 SMART
ZnF_C2H2 388 410 3.5e-5 SMART
ZnF_C2H2 421 444 1.1e-3 SMART
ZnF_C2H2 462 484 7.2e-7 SMART
ZnF_C2H2 490 513 5.9e-3 SMART
ZnF_C2H2 517 540 4.7e-6 SMART
ZnF_C2H2 546 568 5.7e-5 SMART
ZnF_C2H2 574 596 1.3e-4 SMART
ZnF_C2H2 602 624 3e-6 SMART
ZnF_C2H2 630 653 1.5e-5 SMART
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,459 probably null Het
Adam33 T C 2: 131,063,524 probably benign Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Atrn T C 2: 130,964,930 probably null Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cdnf A G 2: 3,521,023 Y84C probably damaging Het
Chdh T C 14: 30,035,340 S407P probably damaging Het
Cmtr1 C A 17: 29,685,975 T300K probably damaging Het
Dennd2d A T 3: 106,482,623 probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
Erbb4 T C 1: 68,040,337 T1195A probably benign Het
Ermard T A 17: 15,053,376 S408T probably benign Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
F13b T A 1: 139,501,770 F9I unknown Het
Fnbp4 C T 2: 90,758,477 R531* probably null Het
Gdf6 A G 4: 9,844,776 Y100C probably damaging Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm2016 A T 12: 87,876,940 D119V possibly damaging Het
Gm9774 A C 3: 92,428,888 probably benign Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Grm8 T C 6: 27,760,209 H374R probably benign Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs A G 11: 120,477,376 K277E probably damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hoxa11 A T 6: 52,245,524 Y66N probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igdcc4 T A 9: 65,131,765 L944Q probably damaging Het
Ighv3-1 C A 12: 113,964,487 S84I probably damaging Het
Iqgap2 T C 13: 95,657,867 D1199G probably damaging Het
Kcnk10 A T 12: 98,434,946 M490K probably benign Het
Kirrel A G 3: 87,085,080 probably null Het
Lias A T 5: 65,395,425 T124S probably benign Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Lrrc37a T A 11: 103,497,982 T2206S unknown Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mis12 A G 11: 71,025,308 T56A probably benign Het
Olfr1118 T A 2: 87,308,864 M25K probably null Het
Olfr1287 A G 2: 111,449,503 D121G probably damaging Het
Olfr1451 T C 19: 12,999,871 V295A probably damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Otof A T 5: 30,419,506 L134Q possibly damaging Het
Pds5b T A 5: 150,794,359 V1155E possibly damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phyhipl C T 10: 70,569,073 V57I probably damaging Het
Plekha5 T A 6: 140,555,921 probably null Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Proser1 A G 3: 53,478,541 T615A probably damaging Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rassf2 G A 2: 132,012,602 P7S probably benign Het
Sart1 A T 19: 5,382,743 L521Q possibly damaging Het
Scgb1b21 T A 7: 33,527,693 noncoding transcript Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Secisbp2l A G 2: 125,751,865 probably benign Het
Svil A G 18: 5,063,522 E931G probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tdrd1 A G 19: 56,831,073 M2V probably benign Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tram1 A G 1: 13,566,375 V358A probably benign Het
Unc13c C T 9: 73,736,539 W1214* probably null Het
Vps13b T C 15: 35,455,128 C728R probably damaging Het
Wwox A G 8: 114,439,741 probably benign Het
Zfp777 T C 6: 48,025,522 S589G probably benign Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Zbtb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Zbtb41 APN 1 139430324 missense probably benign 0.01
IGL01796:Zbtb41 APN 1 139442883 missense probably damaging 0.99
IGL01844:Zbtb41 APN 1 139447327 missense probably benign 0.01
IGL02150:Zbtb41 APN 1 139440448 missense possibly damaging 0.73
IGL02346:Zbtb41 APN 1 139447100 missense probably damaging 1.00
IGL03139:Zbtb41 APN 1 139423838 missense probably benign 0.00
IGL03215:Zbtb41 APN 1 139446950 missense probably damaging 1.00
IGL03309:Zbtb41 APN 1 139432078 critical splice donor site probably null
memorialized UTSW 1 139440394 missense probably benign 0.00
Noted UTSW 1 139439031 missense probably damaging 0.99
unforgotten UTSW 1 139432078 critical splice donor site probably null
R0004:Zbtb41 UTSW 1 139442888 missense possibly damaging 0.90
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0048:Zbtb41 UTSW 1 139441834 missense probably damaging 1.00
R0230:Zbtb41 UTSW 1 139446935 missense probably damaging 1.00
R0309:Zbtb41 UTSW 1 139438984 missense probably damaging 0.99
R0458:Zbtb41 UTSW 1 139423476 missense probably damaging 1.00
R0606:Zbtb41 UTSW 1 139423610 missense probably benign 0.28
R0964:Zbtb41 UTSW 1 139439031 missense probably damaging 0.99
R1531:Zbtb41 UTSW 1 139423193 missense probably benign 0.00
R1723:Zbtb41 UTSW 1 139423563 missense probably benign 0.39
R1765:Zbtb41 UTSW 1 139440394 missense probably benign 0.00
R1829:Zbtb41 UTSW 1 139446922 nonsense probably null
R2077:Zbtb41 UTSW 1 139424093 missense probably damaging 1.00
R2292:Zbtb41 UTSW 1 139440359 missense probably damaging 0.99
R2380:Zbtb41 UTSW 1 139423814 missense probably damaging 0.99
R2402:Zbtb41 UTSW 1 139423185 missense probably benign 0.10
R2402:Zbtb41 UTSW 1 139423187 nonsense probably null
R3847:Zbtb41 UTSW 1 139423996 missense probably benign
R3848:Zbtb41 UTSW 1 139423996 missense probably benign
R3849:Zbtb41 UTSW 1 139423996 missense probably benign
R4641:Zbtb41 UTSW 1 139442819 missense probably damaging 0.98
R4772:Zbtb41 UTSW 1 139447414 missense probably damaging 1.00
R5646:Zbtb41 UTSW 1 139423763 missense probably benign 0.05
R5754:Zbtb41 UTSW 1 139432078 critical splice donor site probably null
R6002:Zbtb41 UTSW 1 139423659 missense probably damaging 1.00
R6045:Zbtb41 UTSW 1 139424032 missense probably benign 0.34
R6302:Zbtb41 UTSW 1 139429289 missense possibly damaging 0.67
R6318:Zbtb41 UTSW 1 139430306 missense possibly damaging 0.91
R6430:Zbtb41 UTSW 1 139447207 missense probably benign 0.02
R6906:Zbtb41 UTSW 1 139423390 missense possibly damaging 0.59
R7584:Zbtb41 UTSW 1 139424057 missense probably benign 0.14
R7753:Zbtb41 UTSW 1 139447157 missense probably benign
Z1177:Zbtb41 UTSW 1 139423416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTGAGAAGCCTTTTGAGTG -3'
(R):5'- CCATGAATTTCTGAAGGCATACTTG -3'

Sequencing Primer
(F):5'- AGTGTGATATTTGTCACCAGCG -3'
(R):5'- TCTGGTGCATCTGAAGACAGCTAC -3'
Posted On2015-05-15