Mutagenetix > Incidental Mutation

Incidental Mutation 'R4077:Atrn'

316599

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

041622-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 130964930 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781] [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably null
Transcript: ENSMUST00000028781

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000028781

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134964

Meta Mutation Damage Score

0.9498

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd12	T	A	2: 150,848,459		probably null	Het
Adam33	T	C	2: 131,063,524		probably benign	Het
Akap8	C	T	17: 32,312,298	R380Q	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cdk11b	C	T	4: 155,639,747		probably benign	Het
Cdnf	A	G	2: 3,521,023	Y84C	probably damaging	Het
Chdh	T	C	14: 30,035,340	S407P	probably damaging	Het
Cmtr1	C	A	17: 29,685,975	T300K	probably damaging	Het
Dennd2d	A	T	3: 106,482,623		probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
Erbb4	T	C	1: 68,040,337	T1195A	probably benign	Het
Ermard	T	A	17: 15,053,376	S408T	probably benign	Het
Etl4	A	T	2: 20,807,961	R1442S	probably damaging	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fnbp4	C	T	2: 90,758,477	R531*	probably null	Het
Gdf6	A	G	4: 9,844,776	Y100C	probably damaging	Het
Gm2016	A	G	12: 87,876,631	K16R	unknown	Het
Gm2016	A	T	12: 87,876,940	D119V	possibly damaging	Het
Gm9774	A	C	3: 92,428,888		probably benign	Het
Gpr3	T	C	4: 133,210,915	T149A	probably damaging	Het
Grm8	T	C	6: 27,760,209	H374R	probably benign	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	A	G	11: 120,477,376	K277E	probably damaging	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Hoxa11	A	T	6: 52,245,524	Y66N	probably damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Igdcc4	T	A	9: 65,131,765	L944Q	probably damaging	Het
Ighv3-1	C	A	12: 113,964,487	S84I	probably damaging	Het
Iqgap2	T	C	13: 95,657,867	D1199G	probably damaging	Het
Kcnk10	A	T	12: 98,434,946	M490K	probably benign	Het
Kirrel	A	G	3: 87,085,080		probably null	Het
Lias	A	T	5: 65,395,425	T124S	probably benign	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Lrrc37a	T	A	11: 103,497,982	T2206S	unknown	Het
Macf1	T	A	4: 123,472,091	Q2959L	probably benign	Het
Mis12	A	G	11: 71,025,308	T56A	probably benign	Het
Olfr1118	T	A	2: 87,308,864	M25K	probably null	Het
Olfr1287	A	G	2: 111,449,503	D121G	probably damaging	Het
Olfr1451	T	C	19: 12,999,871	V295A	probably damaging	Het
Olfr365	T	A	2: 37,202,012	I257N	possibly damaging	Het
Otof	A	T	5: 30,419,506	L134Q	possibly damaging	Het
Pds5b	T	A	5: 150,794,359	V1155E	possibly damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phyhipl	C	T	10: 70,569,073	V57I	probably damaging	Het
Plekha5	T	A	6: 140,555,921		probably null	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Proser1	A	G	3: 53,478,541	T615A	probably damaging	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rassf2	G	A	2: 132,012,602	P7S	probably benign	Het
Sart1	A	T	19: 5,382,743	L521Q	possibly damaging	Het
Scgb1b21	T	A	7: 33,527,693		noncoding transcript	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Secisbp2l	A	G	2: 125,751,865		probably benign	Het
Svil	A	G	18: 5,063,522	E931G	probably benign	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tdrd1	A	G	19: 56,831,073	M2V	probably benign	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tram1	A	G	1: 13,566,375	V358A	probably benign	Het
Unc13c	C	T	9: 73,736,539	W1214*	probably null	Het
Vps13b	T	C	15: 35,455,128	C728R	probably damaging	Het
Wwox	A	G	8: 114,439,741		probably benign	Het
Zbtb41	G	A	1: 139,429,326	V440I	probably benign	Het
Zfp777	T	C	6: 48,025,522	S589G	probably benign	Het
Zfp955a	A	G	17: 33,241,701	Y486H	probably benign	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGCTGTGGATGAGGCATTC -3'
(R):5'- AGACTTCAGACTTGCTCTTTGAC -3'

Sequencing Primer
(F):5'- ACCTGGCTGTCTGAAACTCAGTAG -3'
(R):5'- AGACTTGCTCTTTGACCCCATAAC -3'

Posted On

2015-05-15