Incidental Mutation 'R4077:Arhgef12'
ID316626
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene NameRho guanine nucleotide exchange factor (GEF) 12
SynonymsLARG, 2310014B11Rik
MMRRC Submission 041622-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R4077 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42963842-43107239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42975292 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1131 (M1131V)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072767
AA Change: M1130V

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: M1130V

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165665
AA Change: M1131V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: M1131V

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Meta Mutation Damage Score 0.0987 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,459 probably null Het
Adam33 T C 2: 131,063,524 probably benign Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Atrn T C 2: 130,964,930 probably null Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cdnf A G 2: 3,521,023 Y84C probably damaging Het
Chdh T C 14: 30,035,340 S407P probably damaging Het
Cmtr1 C A 17: 29,685,975 T300K probably damaging Het
Dennd2d A T 3: 106,482,623 probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
Erbb4 T C 1: 68,040,337 T1195A probably benign Het
Ermard T A 17: 15,053,376 S408T probably benign Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
F13b T A 1: 139,501,770 F9I unknown Het
Fnbp4 C T 2: 90,758,477 R531* probably null Het
Gdf6 A G 4: 9,844,776 Y100C probably damaging Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm2016 A T 12: 87,876,940 D119V possibly damaging Het
Gm9774 A C 3: 92,428,888 probably benign Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Grm8 T C 6: 27,760,209 H374R probably benign Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs A G 11: 120,477,376 K277E probably damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hoxa11 A T 6: 52,245,524 Y66N probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igdcc4 T A 9: 65,131,765 L944Q probably damaging Het
Ighv3-1 C A 12: 113,964,487 S84I probably damaging Het
Iqgap2 T C 13: 95,657,867 D1199G probably damaging Het
Kcnk10 A T 12: 98,434,946 M490K probably benign Het
Kirrel A G 3: 87,085,080 probably null Het
Lias A T 5: 65,395,425 T124S probably benign Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Lrrc37a T A 11: 103,497,982 T2206S unknown Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mis12 A G 11: 71,025,308 T56A probably benign Het
Olfr1118 T A 2: 87,308,864 M25K probably null Het
Olfr1287 A G 2: 111,449,503 D121G probably damaging Het
Olfr1451 T C 19: 12,999,871 V295A probably damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Otof A T 5: 30,419,506 L134Q possibly damaging Het
Pds5b T A 5: 150,794,359 V1155E possibly damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phyhipl C T 10: 70,569,073 V57I probably damaging Het
Plekha5 T A 6: 140,555,921 probably null Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Proser1 A G 3: 53,478,541 T615A probably damaging Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rassf2 G A 2: 132,012,602 P7S probably benign Het
Sart1 A T 19: 5,382,743 L521Q possibly damaging Het
Scgb1b21 T A 7: 33,527,693 noncoding transcript Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Secisbp2l A G 2: 125,751,865 probably benign Het
Svil A G 18: 5,063,522 E931G probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tdrd1 A G 19: 56,831,073 M2V probably benign Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tram1 A G 1: 13,566,375 V358A probably benign Het
Unc13c C T 9: 73,736,539 W1214* probably null Het
Vps13b T C 15: 35,455,128 C728R probably damaging Het
Wwox A G 8: 114,439,741 probably benign Het
Zbtb41 G A 1: 139,429,326 V440I probably benign Het
Zfp777 T C 6: 48,025,522 S589G probably benign Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 43020624 missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42982000 missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42990055 missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 43022841 missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42972267 missense probably benign
IGL02135:Arhgef12 APN 9 42972165 missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 43001452 missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42982043 missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42992563 missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 43005623 missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 43005904 nonsense probably null
IGL02803:Arhgef12 APN 9 42972028 missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 43000972 missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 43015920 missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42999077 missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 43026228 missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42974570 missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42992533 splice site probably benign
IGL03398:Arhgef12 APN 9 42978226 missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42978233 missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 43005594 missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42972004 missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42970990 splice site probably null
R0658:Arhgef12 UTSW 9 42981985 missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42993028 missense probably benign 0.02
R0693:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42972381 missense probably benign 0.00
R1147:Arhgef12 UTSW 9 43044256 unclassified probably benign
R1395:Arhgef12 UTSW 9 43005870 missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 43027220 missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42992578 splice site probably benign
R1458:Arhgef12 UTSW 9 42988998 missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42997660 missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 43020717 makesense probably null
R1773:Arhgef12 UTSW 9 43005542 critical splice donor site probably null
R1895:Arhgef12 UTSW 9 43005856 missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42979472 missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 43005871 missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 43001006 missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R4079:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42972274 missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 43018349 nonsense probably null
R4327:Arhgef12 UTSW 9 42975229 nonsense probably null
R4462:Arhgef12 UTSW 9 42981982 missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42977662 missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42981970 missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42972153 missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 43020696 missense probably benign
R4840:Arhgef12 UTSW 9 42975068 missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42993065 nonsense probably null
R5176:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42986584 missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R5838:Arhgef12 UTSW 9 43005608 missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42988965 missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42972207 missense probably benign 0.05
R6959:Arhgef12 UTSW 9 43015953 missense probably benign
R7252:Arhgef12 UTSW 9 43015909 missense probably benign 0.17
R7470:Arhgef12 UTSW 9 43040552 missense probably damaging 1.00
R7658:Arhgef12 UTSW 9 42992536 missense probably damaging 1.00
R7724:Arhgef12 UTSW 9 43027271 missense probably damaging 1.00
R8074:Arhgef12 UTSW 9 42971103 nonsense probably null
RF020:Arhgef12 UTSW 9 42989989 missense possibly damaging 0.75
Z1176:Arhgef12 UTSW 9 42971072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCCACTTTTAACTTGGCTGG -3'
(R):5'- GAGAACAATGTTCAGAAGTTCCAAG -3'

Sequencing Primer
(F):5'- GGCTGGTTCTTCTTCATCATTG -3'
(R):5'- AAAGGAGTAATGTGCTCATGTTAG -3'
Posted On2015-05-15