Incidental Mutation 'R4077:Ermard'
ID316647
Institutional Source Beutler Lab
Gene Symbol Ermard
Ensembl Gene ENSMUSG00000036552
Gene NameER membrane associated RNA degradation
Synonyms2410011O22Rik, 2210404J11Rik
MMRRC Submission 041622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4077 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15041208-15090044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15053376 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 408 (S408T)
Ref Sequence ENSEMBL: ENSMUSP00000095005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040594] [ENSMUST00000097393] [ENSMUST00000227252] [ENSMUST00000228803]
Predicted Effect probably benign
Transcript: ENSMUST00000040594
SMART Domains Protein: ENSMUSP00000043677
Gene: ENSMUSG00000036552

DomainStartEndE-ValueType
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097393
AA Change: S408T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095005
Gene: ENSMUSG00000036552
AA Change: S408T

DomainStartEndE-ValueType
Pfam:DUF4209 133 214 3.1e-27 PFAM
low complexity region 390 399 N/A INTRINSIC
SCOP:g1pnb.1 429 478 4e-3 SMART
low complexity region 583 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227177
Predicted Effect probably benign
Transcript: ENSMUST00000227252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227786
Predicted Effect probably benign
Transcript: ENSMUST00000228803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231568
Meta Mutation Damage Score 0.1133 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains 2 transmembrane domains near the C-terminus and is localized in the endoplasmic reticulum. Knockout of this gene in developing rat brain showed that it may be involved in neuronal migration. Mutations in this gene are associated with periventricular nodular heterotopia-6 (PVNH6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,459 probably null Het
Adam33 T C 2: 131,063,524 probably benign Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Atrn T C 2: 130,964,930 probably null Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cdnf A G 2: 3,521,023 Y84C probably damaging Het
Chdh T C 14: 30,035,340 S407P probably damaging Het
Cmtr1 C A 17: 29,685,975 T300K probably damaging Het
Dennd2d A T 3: 106,482,623 probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
Erbb4 T C 1: 68,040,337 T1195A probably benign Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
F13b T A 1: 139,501,770 F9I unknown Het
Fnbp4 C T 2: 90,758,477 R531* probably null Het
Gdf6 A G 4: 9,844,776 Y100C probably damaging Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm2016 A T 12: 87,876,940 D119V possibly damaging Het
Gm9774 A C 3: 92,428,888 probably benign Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Grm8 T C 6: 27,760,209 H374R probably benign Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs A G 11: 120,477,376 K277E probably damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hoxa11 A T 6: 52,245,524 Y66N probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igdcc4 T A 9: 65,131,765 L944Q probably damaging Het
Ighv3-1 C A 12: 113,964,487 S84I probably damaging Het
Iqgap2 T C 13: 95,657,867 D1199G probably damaging Het
Kcnk10 A T 12: 98,434,946 M490K probably benign Het
Kirrel A G 3: 87,085,080 probably null Het
Lias A T 5: 65,395,425 T124S probably benign Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Lrrc37a T A 11: 103,497,982 T2206S unknown Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mis12 A G 11: 71,025,308 T56A probably benign Het
Olfr1118 T A 2: 87,308,864 M25K probably null Het
Olfr1287 A G 2: 111,449,503 D121G probably damaging Het
Olfr1451 T C 19: 12,999,871 V295A probably damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Otof A T 5: 30,419,506 L134Q possibly damaging Het
Pds5b T A 5: 150,794,359 V1155E possibly damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phyhipl C T 10: 70,569,073 V57I probably damaging Het
Plekha5 T A 6: 140,555,921 probably null Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Proser1 A G 3: 53,478,541 T615A probably damaging Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rassf2 G A 2: 132,012,602 P7S probably benign Het
Sart1 A T 19: 5,382,743 L521Q possibly damaging Het
Scgb1b21 T A 7: 33,527,693 noncoding transcript Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Secisbp2l A G 2: 125,751,865 probably benign Het
Svil A G 18: 5,063,522 E931G probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tdrd1 A G 19: 56,831,073 M2V probably benign Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tram1 A G 1: 13,566,375 V358A probably benign Het
Unc13c C T 9: 73,736,539 W1214* probably null Het
Vps13b T C 15: 35,455,128 C728R probably damaging Het
Wwox A G 8: 114,439,741 probably benign Het
Zbtb41 G A 1: 139,429,326 V440I probably benign Het
Zfp777 T C 6: 48,025,522 S589G probably benign Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Ermard
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ermard APN 17 14988066 splice site probably benign
IGL01554:Ermard APN 17 15051593 missense possibly damaging 0.94
IGL01832:Ermard APN 17 15059849 missense probably damaging 0.98
IGL02045:Ermard APN 17 15051564 unclassified probably benign
IGL02332:Ermard APN 17 14990545 critical splice acceptor site probably null
IGL02525:Ermard APN 17 15059339 splice site probably benign
IGL03335:Ermard APN 17 15059406 missense probably damaging 1.00
Eminence UTSW 17 15053205 splice site probably null
PIT4504001:Ermard UTSW 17 15058822 nonsense probably null
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0722:Ermard UTSW 17 15022128 missense probably benign 0.13
R0785:Ermard UTSW 17 15021977 missense probably damaging 1.00
R2019:Ermard UTSW 17 15053265 missense probably damaging 1.00
R3696:Ermard UTSW 17 15053376 missense probably benign 0.01
R3697:Ermard UTSW 17 15053376 missense probably benign 0.01
R4383:Ermard UTSW 17 15059866 missense possibly damaging 0.87
R5424:Ermard UTSW 17 15059770 missense possibly damaging 0.73
R6313:Ermard UTSW 17 15053205 splice site probably null
R7685:Ermard UTSW 17 15059462 missense probably benign 0.00
R7800:Ermard UTSW 17 15056803 missense probably benign 0.01
R7802:Ermard UTSW 17 15061161 missense probably benign
R7895:Ermard UTSW 17 15063613 missense possibly damaging 0.66
R7978:Ermard UTSW 17 15063613 missense possibly damaging 0.66
R8203:Ermard UTSW 17 15020286 missense not run
Predicted Primers PCR Primer
(F):5'- AGGATACCCTGCCATTCACTC -3'
(R):5'- AGCTTCAGAACCCAGACTTTTAG -3'

Sequencing Primer
(F):5'- GAACACTGACAGAATGTTTCTCTGTC -3'
(R):5'- CCCAGACTTTTAGAGAATGTACAC -3'
Posted On2015-05-15