Incidental Mutation 'R4077:Tjp2'
ID316656
Institutional Source Beutler Lab
Gene Symbol Tjp2
Ensembl Gene ENSMUSG00000024812
Gene Nametight junction protein 2
SynonymsZO-2
MMRRC Submission 041622-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4077 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location24094523-24225026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24108818 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 780 (V780E)
Ref Sequence ENSEMBL: ENSMUSP00000097154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099558]
PDB Structure
Solution structure of N-terminal PDZ domain from mouse TJP2 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099558
AA Change: V780E

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097154
Gene: ENSMUSG00000024812
AA Change: V780E

DomainStartEndE-ValueType
PDZ 19 97 1.25e-15 SMART
low complexity region 163 178 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
PDZ 297 365 8.73e-15 SMART
low complexity region 377 390 N/A INTRINSIC
PDZ 499 572 1.57e-16 SMART
SH3 587 648 1.07e-2 SMART
GuKc 672 861 3.25e-42 SMART
low complexity region 969 980 N/A INTRINSIC
low complexity region 1037 1049 N/A INTRINSIC
coiled coil region 1063 1090 N/A INTRINSIC
Meta Mutation Damage Score 0.9690 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zonula occluden that is a member of the membrane-associated guanylate kinase homolog family. The encoded protein functions as a component of the tight junction barrier in epithelial and endothelial cells and is necessary for proper assembly of tight junctions. Mutations in this gene have been identified in patients with hypercholanemia, and genomic duplication of a 270 kb region including this gene causes autosomal dominant deafness-51. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation due to arrest in early gastrulation. Structure and permeability barrier of the apical junctional complex are altered in cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,459 probably null Het
Adam33 T C 2: 131,063,524 probably benign Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Atrn T C 2: 130,964,930 probably null Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cdnf A G 2: 3,521,023 Y84C probably damaging Het
Chdh T C 14: 30,035,340 S407P probably damaging Het
Cmtr1 C A 17: 29,685,975 T300K probably damaging Het
Dennd2d A T 3: 106,482,623 probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
Erbb4 T C 1: 68,040,337 T1195A probably benign Het
Ermard T A 17: 15,053,376 S408T probably benign Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
F13b T A 1: 139,501,770 F9I unknown Het
Fnbp4 C T 2: 90,758,477 R531* probably null Het
Gdf6 A G 4: 9,844,776 Y100C probably damaging Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm2016 A T 12: 87,876,940 D119V possibly damaging Het
Gm9774 A C 3: 92,428,888 probably benign Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Grm8 T C 6: 27,760,209 H374R probably benign Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs A G 11: 120,477,376 K277E probably damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hoxa11 A T 6: 52,245,524 Y66N probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igdcc4 T A 9: 65,131,765 L944Q probably damaging Het
Ighv3-1 C A 12: 113,964,487 S84I probably damaging Het
Iqgap2 T C 13: 95,657,867 D1199G probably damaging Het
Kcnk10 A T 12: 98,434,946 M490K probably benign Het
Kirrel A G 3: 87,085,080 probably null Het
Lias A T 5: 65,395,425 T124S probably benign Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Lrrc37a T A 11: 103,497,982 T2206S unknown Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mis12 A G 11: 71,025,308 T56A probably benign Het
Olfr1118 T A 2: 87,308,864 M25K probably null Het
Olfr1287 A G 2: 111,449,503 D121G probably damaging Het
Olfr1451 T C 19: 12,999,871 V295A probably damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Otof A T 5: 30,419,506 L134Q possibly damaging Het
Pds5b T A 5: 150,794,359 V1155E possibly damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phyhipl C T 10: 70,569,073 V57I probably damaging Het
Plekha5 T A 6: 140,555,921 probably null Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Proser1 A G 3: 53,478,541 T615A probably damaging Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rassf2 G A 2: 132,012,602 P7S probably benign Het
Sart1 A T 19: 5,382,743 L521Q possibly damaging Het
Scgb1b21 T A 7: 33,527,693 noncoding transcript Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Secisbp2l A G 2: 125,751,865 probably benign Het
Svil A G 18: 5,063,522 E931G probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tdrd1 A G 19: 56,831,073 M2V probably benign Het
Tram1 A G 1: 13,566,375 V358A probably benign Het
Unc13c C T 9: 73,736,539 W1214* probably null Het
Vps13b T C 15: 35,455,128 C728R probably damaging Het
Wwox A G 8: 114,439,741 probably benign Het
Zbtb41 G A 1: 139,429,326 V440I probably benign Het
Zfp777 T C 6: 48,025,522 S589G probably benign Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Tjp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Tjp2 APN 19 24138810 missense possibly damaging 0.89
IGL01412:Tjp2 APN 19 24100775 missense probably damaging 0.99
IGL01681:Tjp2 APN 19 24134849 critical splice donor site probably null
IGL02044:Tjp2 APN 19 24120840 missense probably damaging 1.00
IGL02212:Tjp2 APN 19 24138786 missense probably damaging 1.00
IGL02629:Tjp2 APN 19 24122379 splice site probably benign
IGL02819:Tjp2 APN 19 24114105 missense probably damaging 0.98
IGL02931:Tjp2 APN 19 24096632 missense probably benign 0.11
PIT4402001:Tjp2 UTSW 19 24098129 nonsense probably null
R0032:Tjp2 UTSW 19 24108695 missense probably damaging 1.00
R0667:Tjp2 UTSW 19 24108749 missense probably benign 0.36
R0674:Tjp2 UTSW 19 24131316 missense probably benign 0.37
R0749:Tjp2 UTSW 19 24122272 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1563:Tjp2 UTSW 19 24132703 missense probably damaging 0.99
R1571:Tjp2 UTSW 19 24100875 missense probably damaging 1.00
R1624:Tjp2 UTSW 19 24131412 missense probably benign 0.01
R1658:Tjp2 UTSW 19 24112947 missense probably damaging 0.99
R1851:Tjp2 UTSW 19 24099535 missense possibly damaging 0.67
R1968:Tjp2 UTSW 19 24111073 missense probably damaging 0.99
R2068:Tjp2 UTSW 19 24122323 missense probably benign 0.22
R2273:Tjp2 UTSW 19 24112807 missense probably benign
R2994:Tjp2 UTSW 19 24112851 missense probably damaging 1.00
R3767:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R3770:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R4079:Tjp2 UTSW 19 24108818 missense possibly damaging 0.90
R4505:Tjp2 UTSW 19 24108831 missense possibly damaging 0.50
R4720:Tjp2 UTSW 19 24100805 missense probably damaging 1.00
R4739:Tjp2 UTSW 19 24120111 intron probably null
R4745:Tjp2 UTSW 19 24096666 missense possibly damaging 0.56
R4858:Tjp2 UTSW 19 24122120 missense probably damaging 1.00
R5290:Tjp2 UTSW 19 24131204 missense probably benign
R5887:Tjp2 UTSW 19 24096599 missense probably benign
R5988:Tjp2 UTSW 19 24114100 missense probably benign
R6144:Tjp2 UTSW 19 24120073 missense probably damaging 0.99
R6163:Tjp2 UTSW 19 24125704 critical splice donor site probably null
R6183:Tjp2 UTSW 19 24100791 missense probably damaging 0.99
R6242:Tjp2 UTSW 19 24099603 intron probably null
R6683:Tjp2 UTSW 19 24120843 missense probably damaging 0.99
R6866:Tjp2 UTSW 19 24101991 missense probably damaging 0.99
R7025:Tjp2 UTSW 19 24132688 missense probably benign 0.28
R7153:Tjp2 UTSW 19 24101981 missense probably benign 0.40
R7514:Tjp2 UTSW 19 24111522 missense probably benign 0.03
R8004:Tjp2 UTSW 19 24114120 missense probably damaging 1.00
X0066:Tjp2 UTSW 19 24098027 missense probably damaging 1.00
Z1176:Tjp2 UTSW 19 24131365 missense probably benign 0.00
Z1177:Tjp2 UTSW 19 24095460 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AAGCTCCTGATTGCTCATTCTG -3'
(R):5'- GCCATGGAGTTTGAAGGTCAC -3'

Sequencing Primer
(F):5'- TCATTCTGAGCGTGGGCC -3'
(R):5'- CCTGGGCTACGTAATGACTTCAAG -3'
Posted On2015-05-15