Incidental Mutation 'R4078:Khdrbs2'
ID 316659
Institutional Source Beutler Lab
Gene Symbol Khdrbs2
Ensembl Gene ENSMUSG00000026058
Gene Name KH domain containing, RNA binding, signal transduction associated 2
Synonyms 6330586C16Rik, SLM-1
MMRRC Submission 041623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock # R4078 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 32172714-32658568 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to C at 32519814 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027226]
AlphaFold Q9WU01
Predicted Effect probably benign
Transcript: ENSMUST00000027226
SMART Domains Protein: ENSMUSP00000027226
Gene: ENSMUSG00000026058

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 156 4.93e-7 SMART
low complexity region 185 197 N/A INTRINSIC
low complexity region 204 231 N/A INTRINSIC
Pfam:Sam68-YY 267 321 1.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195252
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: The protein encoded by this gene is similar to the src associated in mitosis, 68 kDa protein, which is an RNA-binding protein and a substrate for Src-family tyrosine kinases during mitosis. This protein has a KH RNA-binding motif and proline-rich motifs which may be SH2 and SH3 domain binding sites. A similar rat protein is an RNA-binding protein which is tyrosine phosphorylated by Src during mitosis. These studies also suggest that the rat protein may function as an adaptor protein for Src by binding the SH2 and SH3 domains of various other proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals display smaller brain size and reduced weight in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,061 L367* probably null Het
Agfg1 T A 1: 82,882,287 S312T possibly damaging Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Ambp T A 4: 63,150,443 K112N probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Asah1 A G 8: 41,354,082 S102P probably damaging Het
Atp10b T C 11: 43,153,283 V112A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cabs1 G A 5: 87,980,302 E271K probably damaging Het
Car8 T C 4: 8,169,731 K259R possibly damaging Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdh4 A G 2: 179,889,173 E616G possibly damaging Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cfap74 A G 4: 155,455,671 D975G probably damaging Het
Col27a1 G T 4: 63,224,432 R119L probably damaging Het
Col7a1 A G 9: 108,960,991 N918S unknown Het
Colec11 T C 12: 28,595,247 N142D possibly damaging Het
Cox7a2 G A 9: 79,758,570 Q10* probably null Het
Cyp2b23 C A 7: 26,673,092 G366V probably damaging Het
Emsy G A 7: 98,590,725 P1108S probably damaging Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
Fam151a G A 4: 106,747,757 G439S probably benign Het
Fat1 C T 8: 44,989,122 P1154S probably damaging Het
Fat4 G A 3: 38,980,020 S2607N probably damaging Het
Fzd7 T A 1: 59,483,789 M277K possibly damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10436 T A 12: 88,175,913 I312F probably benign Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm38706 G T 6: 130,483,737 noncoding transcript Het
Gm9758 T A 5: 14,911,522 probably null Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Heatr9 C A 11: 83,512,428 K428N probably benign Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kcnn3 A G 3: 89,661,188 K591R possibly damaging Het
Lpp G A 16: 24,681,861 R141H probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mipep T A 14: 60,846,477 Y606N probably damaging Het
Mroh5 C A 15: 73,786,040 C547F possibly damaging Het
Nek3 A T 8: 22,132,137 W363R probably damaging Het
Nphs1 T A 7: 30,467,520 Y717* probably null Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr167 T A 16: 19,515,232 M135L possibly damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Olfr508 T A 7: 108,630,907 M305K probably benign Het
Olfr824 G A 10: 130,126,718 T113I probably damaging Het
Optc T C 1: 133,898,349 H270R probably damaging Het
Pik3c2g A G 6: 139,635,610 probably benign Het
Pms1 A T 1: 53,267,789 probably null Het
Prkg1 T C 19: 31,585,578 Y156C probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Slc22a28 T A 19: 8,101,413 H304L probably benign Het
Stox1 C T 10: 62,666,031 C250Y probably benign Het
Sult2a3 A G 7: 14,121,737 W65R possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Syne2 C A 12: 76,035,624 T4857K probably damaging Het
Tcp1 T C 17: 12,918,083 L64S probably benign Het
Thap11 G T 8: 105,855,916 E186* probably null Het
Tmem67 A G 4: 12,040,633 probably null Het
Trappc10 T C 10: 78,210,382 Y458C probably damaging Het
Ufd1 A G 16: 18,825,778 Y197C possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp49 A G 17: 47,674,749 T245A probably damaging Het
Washc1 A T 17: 66,117,161 E289D probably benign Het
Zc3h7a A T 16: 11,151,147 V450E probably benign Het
Zcchc17 T G 4: 130,329,625 I123L possibly damaging Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Khdrbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Khdrbs2 APN 1 32472752 missense probably benign 0.00
IGL01326:Khdrbs2 APN 1 32657477 missense possibly damaging 0.94
IGL01767:Khdrbs2 APN 1 32619176 nonsense probably null
IGL01792:Khdrbs2 APN 1 32657467 missense probably damaging 0.99
IGL01839:Khdrbs2 APN 1 32414862 splice site probably benign
R0046:Khdrbs2 UTSW 1 32619202 missense possibly damaging 0.56
R0079:Khdrbs2 UTSW 1 32519915 splice site probably null
R0396:Khdrbs2 UTSW 1 32519973 missense probably damaging 1.00
R0613:Khdrbs2 UTSW 1 32657522 missense possibly damaging 0.94
R0616:Khdrbs2 UTSW 1 32467775 missense possibly damaging 0.65
R1034:Khdrbs2 UTSW 1 32467791 missense probably damaging 1.00
R1055:Khdrbs2 UTSW 1 32644157 splice site probably benign
R1156:Khdrbs2 UTSW 1 32467875 missense probably benign 0.04
R1456:Khdrbs2 UTSW 1 32520696 missense possibly damaging 0.71
R2007:Khdrbs2 UTSW 1 32520548 missense probably benign 0.04
R2079:Khdrbs2 UTSW 1 32467874 missense probably benign
R2384:Khdrbs2 UTSW 1 32519895 missense probably damaging 0.97
R3123:Khdrbs2 UTSW 1 32519777 missense probably damaging 0.98
R3124:Khdrbs2 UTSW 1 32519777 missense probably damaging 0.98
R3772:Khdrbs2 UTSW 1 32244076 nonsense probably null
R4088:Khdrbs2 UTSW 1 32333524 missense probably damaging 1.00
R4955:Khdrbs2 UTSW 1 32520077 intron probably benign
R5465:Khdrbs2 UTSW 1 32619174 missense probably damaging 1.00
R5668:Khdrbs2 UTSW 1 32467770 missense probably damaging 1.00
R5792:Khdrbs2 UTSW 1 32472692 missense probably damaging 1.00
R6639:Khdrbs2 UTSW 1 32467862 nonsense probably null
R7027:Khdrbs2 UTSW 1 32414916 missense probably benign 0.02
R7380:Khdrbs2 UTSW 1 32333604 missense unknown
R7381:Khdrbs2 UTSW 1 32333802 missense not run
R7939:Khdrbs2 UTSW 1 32172975 missense probably benign 0.27
R8087:Khdrbs2 UTSW 1 32414976 missense probably benign 0.11
R9347:Khdrbs2 UTSW 1 32472747 missense probably benign 0.00
X0020:Khdrbs2 UTSW 1 32414974 missense probably damaging 1.00
Z1088:Khdrbs2 UTSW 1 32244055 intron probably benign
Z1176:Khdrbs2 UTSW 1 32333662 missense unknown
Z1177:Khdrbs2 UTSW 1 32243967 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AAAAGGTCACAGGCTGGTC -3'
(R):5'- GGCTCTGCATGTCTTTAGCAC -3'

Sequencing Primer
(F):5'- GGTCCCTAGCGATGTAATCTGC -3'
(R):5'- TTTACCCCAAACTAAAGCATAGTGG -3'
Posted On 2015-05-15