Incidental Mutation 'R4078:Tmem67'
ID 316670
Institutional Source Beutler Lab
Gene Symbol Tmem67
Ensembl Gene ENSMUSG00000049488
Gene Name transmembrane protein 67
Synonyms b2b1291.1Clo, 5330408M12Rik, b2b1163.1Clo
MMRRC Submission 041623-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4078 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 12039355-12090020 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 12040633 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050686] [ENSMUST00000108293] [ENSMUST00000108293]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000050686
SMART Domains Protein: ENSMUSP00000052644
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 17 23 N/A INTRINSIC
Pfam:Meckelin 166 995 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108293
SMART Domains Protein: ENSMUSP00000103928
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
Pfam:Meckelin 236 1061 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108293
SMART Domains Protein: ENSMUSP00000103928
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
Pfam:Meckelin 236 1061 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130117
Predicted Effect probably benign
Transcript: ENSMUST00000131145
SMART Domains Protein: ENSMUSP00000115154
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the primary cilium and to the plasma membrane. The gene functions in centriole migration to the apical membrane and formation of the primary cilium. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal/postanal lethality, kidney cysts, and Meckel-Gruber or Joubert syndrome-like phenotypes depending on the filial generation of the backcross to C57BL/6J. Mice homozygous for an ENU-induced allele exhibit cardiovascular defects and cystic kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,061 L367* probably null Het
Agfg1 T A 1: 82,882,287 S312T possibly damaging Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Ambp T A 4: 63,150,443 K112N probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Asah1 A G 8: 41,354,082 S102P probably damaging Het
Atp10b T C 11: 43,153,283 V112A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cabs1 G A 5: 87,980,302 E271K probably damaging Het
Car8 T C 4: 8,169,731 K259R possibly damaging Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdh4 A G 2: 179,889,173 E616G possibly damaging Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cfap74 A G 4: 155,455,671 D975G probably damaging Het
Col27a1 G T 4: 63,224,432 R119L probably damaging Het
Col7a1 A G 9: 108,960,991 N918S unknown Het
Colec11 T C 12: 28,595,247 N142D possibly damaging Het
Cox7a2 G A 9: 79,758,570 Q10* probably null Het
Cyp2b23 C A 7: 26,673,092 G366V probably damaging Het
Emsy G A 7: 98,590,725 P1108S probably damaging Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
Fam151a G A 4: 106,747,757 G439S probably benign Het
Fat1 C T 8: 44,989,122 P1154S probably damaging Het
Fat4 G A 3: 38,980,020 S2607N probably damaging Het
Fzd7 T A 1: 59,483,789 M277K possibly damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10436 T A 12: 88,175,913 I312F probably benign Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm38706 G T 6: 130,483,737 noncoding transcript Het
Gm9758 T A 5: 14,911,522 probably null Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Heatr9 C A 11: 83,512,428 K428N probably benign Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kcnn3 A G 3: 89,661,188 K591R possibly damaging Het
Khdrbs2 T C 1: 32,519,814 probably benign Het
Lpp G A 16: 24,681,861 R141H probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mipep T A 14: 60,846,477 Y606N probably damaging Het
Mroh5 C A 15: 73,786,040 C547F possibly damaging Het
Nek3 A T 8: 22,132,137 W363R probably damaging Het
Nphs1 T A 7: 30,467,520 Y717* probably null Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr167 T A 16: 19,515,232 M135L possibly damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Olfr508 T A 7: 108,630,907 M305K probably benign Het
Olfr824 G A 10: 130,126,718 T113I probably damaging Het
Optc T C 1: 133,898,349 H270R probably damaging Het
Pik3c2g A G 6: 139,635,610 probably benign Het
Pms1 A T 1: 53,267,789 probably null Het
Prkg1 T C 19: 31,585,578 Y156C probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Slc22a28 T A 19: 8,101,413 H304L probably benign Het
Stox1 C T 10: 62,666,031 C250Y probably benign Het
Sult2a3 A G 7: 14,121,737 W65R possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Syne2 C A 12: 76,035,624 T4857K probably damaging Het
Tcp1 T C 17: 12,918,083 L64S probably benign Het
Thap11 G T 8: 105,855,916 E186* probably null Het
Trappc10 T C 10: 78,210,382 Y458C probably damaging Het
Ufd1 A G 16: 18,825,778 Y197C possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp49 A G 17: 47,674,749 T245A probably damaging Het
Washc1 A T 17: 66,117,161 E289D probably benign Het
Zc3h7a A T 16: 11,151,147 V450E probably benign Het
Zcchc17 T G 4: 130,329,625 I123L possibly damaging Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Tmem67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Tmem67 APN 4 12061826 missense probably damaging 0.98
IGL00768:Tmem67 APN 4 12055029 critical splice donor site probably null
IGL00813:Tmem67 APN 4 12058587 splice site probably benign
IGL01070:Tmem67 APN 4 12054750 missense probably benign 0.20
IGL01088:Tmem67 APN 4 12063126 missense probably damaging 1.00
IGL01353:Tmem67 APN 4 12079895 missense probably damaging 1.00
IGL01490:Tmem67 APN 4 12057422 splice site probably benign
IGL01885:Tmem67 APN 4 12057389 missense probably damaging 1.00
IGL02061:Tmem67 APN 4 12053526 missense probably damaging 1.00
IGL02151:Tmem67 APN 4 12068882 missense probably benign 0.35
IGL02166:Tmem67 APN 4 12047313 missense possibly damaging 0.90
IGL02243:Tmem67 APN 4 12070584 missense possibly damaging 0.93
IGL02517:Tmem67 APN 4 12069463 missense possibly damaging 0.67
IGL02736:Tmem67 APN 4 12045789 splice site probably null
R0282:Tmem67 UTSW 4 12087930 missense probably damaging 0.99
R0514:Tmem67 UTSW 4 12089317 missense probably benign
R1221:Tmem67 UTSW 4 12045871 missense possibly damaging 0.92
R1301:Tmem67 UTSW 4 12089400 unclassified probably benign
R1581:Tmem67 UTSW 4 12047814 missense probably damaging 1.00
R1680:Tmem67 UTSW 4 12087840 missense probably benign 0.00
R1804:Tmem67 UTSW 4 12045789 splice site probably null
R2174:Tmem67 UTSW 4 12063730 nonsense probably null
R2191:Tmem67 UTSW 4 12069413 critical splice donor site probably null
R2246:Tmem67 UTSW 4 12040651 missense probably damaging 1.00
R2566:Tmem67 UTSW 4 12079918 missense probably damaging 0.99
R3409:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R3410:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R4282:Tmem67 UTSW 4 12073922 missense probably damaging 0.99
R4429:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4430:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4431:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4734:Tmem67 UTSW 4 12063158 missense probably benign 0.00
R4856:Tmem67 UTSW 4 12089416 unclassified probably benign
R4865:Tmem67 UTSW 4 12070262 missense probably benign 0.01
R5056:Tmem67 UTSW 4 12070471 missense probably benign 0.29
R5575:Tmem67 UTSW 4 12047886 missense possibly damaging 0.93
R5614:Tmem67 UTSW 4 12061755 missense possibly damaging 0.54
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6182:Tmem67 UTSW 4 12051402 missense probably benign 0.05
R6562:Tmem67 UTSW 4 12053445 critical splice donor site probably null
R6574:Tmem67 UTSW 4 12063086 missense possibly damaging 0.70
R6696:Tmem67 UTSW 4 12061754 critical splice donor site probably null
R6824:Tmem67 UTSW 4 12051449 missense probably damaging 1.00
R7028:Tmem67 UTSW 4 12075484 missense probably benign 0.12
R7174:Tmem67 UTSW 4 12077337 missense possibly damaging 0.82
R7369:Tmem67 UTSW 4 12053535 missense probably damaging 1.00
R7638:Tmem67 UTSW 4 12079883 missense probably benign 0.17
R7671:Tmem67 UTSW 4 12063698 missense probably benign 0.00
R7736:Tmem67 UTSW 4 12053455 missense probably benign 0.09
R7920:Tmem67 UTSW 4 12089284 critical splice donor site probably null
R7981:Tmem67 UTSW 4 12070592 missense probably damaging 1.00
R8005:Tmem67 UTSW 4 12047821 missense probably damaging 1.00
R8086:Tmem67 UTSW 4 12040738 missense probably damaging 1.00
R8196:Tmem67 UTSW 4 12075661 missense probably benign 0.00
R8344:Tmem67 UTSW 4 12058576 missense probably benign 0.00
R8350:Tmem67 UTSW 4 12087891 missense probably benign 0.07
R8450:Tmem67 UTSW 4 12087891 missense probably benign 0.07
R8899:Tmem67 UTSW 4 12055038 missense probably damaging 0.99
R8992:Tmem67 UTSW 4 12058559 missense probably damaging 1.00
R9281:Tmem67 UTSW 4 12079962 missense possibly damaging 0.90
R9335:Tmem67 UTSW 4 12040640 nonsense probably null
R9539:Tmem67 UTSW 4 12045814 missense probably damaging 1.00
R9539:Tmem67 UTSW 4 12045815 missense probably damaging 1.00
Z1176:Tmem67 UTSW 4 12087983 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTTTATTGACCCCAGGGACAG -3'
(R):5'- AGAGGGTAGCACAGACCTTTTC -3'

Sequencing Primer
(F):5'- ACAGAGTGCACTGGGGTCTG -3'
(R):5'- GACACTGTTTGACACATCTTGCAC -3'
Posted On 2015-05-15