Incidental Mutation 'R4078:Nphs1'
ID316689
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Namenephrosis 1, nephrin
Synonymsnephrin
MMRRC Submission 041623-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4078 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30458315-30487223 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 30467520 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 717 (Y717*)
Ref Sequence ENSEMBL: ENSMUSP00000116500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
Predicted Effect probably null
Transcript: ENSMUST00000006825
AA Change: Y731*
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: Y731*

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126297
AA Change: Y717*
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: Y717*

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152625
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,061 L367* probably null Het
Agfg1 T A 1: 82,882,287 S312T possibly damaging Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Ambp T A 4: 63,150,443 K112N probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Asah1 A G 8: 41,354,082 S102P probably damaging Het
Atp10b T C 11: 43,153,283 V112A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cabs1 G A 5: 87,980,302 E271K probably damaging Het
Car8 T C 4: 8,169,731 K259R possibly damaging Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdh4 A G 2: 179,889,173 E616G possibly damaging Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cfap74 A G 4: 155,455,671 D975G probably damaging Het
Col27a1 G T 4: 63,224,432 R119L probably damaging Het
Col7a1 A G 9: 108,960,991 N918S unknown Het
Colec11 T C 12: 28,595,247 N142D possibly damaging Het
Cox7a2 G A 9: 79,758,570 Q10* probably null Het
Cyp2b23 C A 7: 26,673,092 G366V probably damaging Het
Emsy G A 7: 98,590,725 P1108S probably damaging Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
Fam151a G A 4: 106,747,757 G439S probably benign Het
Fat1 C T 8: 44,989,122 P1154S probably damaging Het
Fat4 G A 3: 38,980,020 S2607N probably damaging Het
Fzd7 T A 1: 59,483,789 M277K possibly damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10436 T A 12: 88,175,913 I312F probably benign Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm38706 G T 6: 130,483,737 noncoding transcript Het
Gm9758 T A 5: 14,911,522 probably null Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Heatr9 C A 11: 83,512,428 K428N probably benign Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kcnn3 A G 3: 89,661,188 K591R possibly damaging Het
Khdrbs2 T C 1: 32,519,814 probably benign Het
Lpp G A 16: 24,681,861 R141H probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mipep T A 14: 60,846,477 Y606N probably damaging Het
Mroh5 C A 15: 73,786,040 C547F possibly damaging Het
Nek3 A T 8: 22,132,137 W363R probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr167 T A 16: 19,515,232 M135L possibly damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Olfr508 T A 7: 108,630,907 M305K probably benign Het
Olfr824 G A 10: 130,126,718 T113I probably damaging Het
Optc T C 1: 133,898,349 H270R probably damaging Het
Pik3c2g A G 6: 139,635,610 probably benign Het
Pms1 A T 1: 53,267,789 probably null Het
Prkg1 T C 19: 31,585,578 Y156C probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Slc22a28 T A 19: 8,101,413 H304L probably benign Het
Stox1 C T 10: 62,666,031 C250Y probably benign Het
Sult2a3 A G 7: 14,121,737 W65R possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Syne2 C A 12: 76,035,624 T4857K probably damaging Het
Tcp1 T C 17: 12,918,083 L64S probably benign Het
Thap11 G T 8: 105,855,916 E186* probably null Het
Tmem67 A G 4: 12,040,633 probably null Het
Trappc10 T C 10: 78,210,382 Y458C probably damaging Het
Ufd1 A G 16: 18,825,778 Y197C possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp49 A G 17: 47,674,749 T245A probably damaging Het
Washc1 A T 17: 66,117,161 E289D probably benign Het
Zc3h7a A T 16: 11,151,147 V450E probably benign Het
Zcchc17 T G 4: 130,329,625 I123L possibly damaging Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTCCGTGTCTGCTAAC -3'
(R):5'- ATACCAGAACTGTGCTGGGG -3'

Sequencing Primer
(F):5'- GAGGCCTTCAACTGGACCTTC -3'
(R):5'- CTGGGGTGGGGTCAAGAGAAC -3'
Posted On2015-05-15