Incidental Mutation 'R4078:Emsy'
ID316690
Institutional Source Beutler Lab
Gene Symbol Emsy
Ensembl Gene ENSMUSG00000035401
Gene NameEMSY, BRCA2-interacting transcriptional repressor
Synonyms2210018M11Rik
MMRRC Submission 041623-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.565) question?
Stock #R4078 (G1)
Quality Score207
Status Validated
Chromosome7
Chromosomal Location98587137-98656783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98590725 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1108 (P1108S)
Ref Sequence ENSEMBL: ENSMUSP00000038216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038359] [ENSMUST00000205276] [ENSMUST00000205886] [ENSMUST00000205911]
Predicted Effect probably damaging
Transcript: ENSMUST00000038359
AA Change: P1108S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038216
Gene: ENSMUSG00000035401
AA Change: P1108S

DomainStartEndE-ValueType
ENT 16 88 2.44e-29 SMART
low complexity region 94 104 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
low complexity region 293 331 N/A INTRINSIC
low complexity region 363 406 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 681 698 N/A INTRINSIC
low complexity region 807 816 N/A INTRINSIC
low complexity region 866 882 N/A INTRINSIC
low complexity region 893 909 N/A INTRINSIC
low complexity region 1197 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205276
AA Change: P1254S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205513
Predicted Effect probably benign
Transcript: ENSMUST00000205886
Predicted Effect unknown
Transcript: ENSMUST00000205911
AA Change: P1060S
Meta Mutation Damage Score 0.0794 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,061 L367* probably null Het
Agfg1 T A 1: 82,882,287 S312T possibly damaging Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Ambp T A 4: 63,150,443 K112N probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Asah1 A G 8: 41,354,082 S102P probably damaging Het
Atp10b T C 11: 43,153,283 V112A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cabs1 G A 5: 87,980,302 E271K probably damaging Het
Car8 T C 4: 8,169,731 K259R possibly damaging Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdh4 A G 2: 179,889,173 E616G possibly damaging Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cfap74 A G 4: 155,455,671 D975G probably damaging Het
Col27a1 G T 4: 63,224,432 R119L probably damaging Het
Col7a1 A G 9: 108,960,991 N918S unknown Het
Colec11 T C 12: 28,595,247 N142D possibly damaging Het
Cox7a2 G A 9: 79,758,570 Q10* probably null Het
Cyp2b23 C A 7: 26,673,092 G366V probably damaging Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
Fam151a G A 4: 106,747,757 G439S probably benign Het
Fat1 C T 8: 44,989,122 P1154S probably damaging Het
Fat4 G A 3: 38,980,020 S2607N probably damaging Het
Fzd7 T A 1: 59,483,789 M277K possibly damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10436 T A 12: 88,175,913 I312F probably benign Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm38706 G T 6: 130,483,737 noncoding transcript Het
Gm9758 T A 5: 14,911,522 probably null Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Heatr9 C A 11: 83,512,428 K428N probably benign Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kcnn3 A G 3: 89,661,188 K591R possibly damaging Het
Khdrbs2 T C 1: 32,519,814 probably benign Het
Lpp G A 16: 24,681,861 R141H probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mipep T A 14: 60,846,477 Y606N probably damaging Het
Mroh5 C A 15: 73,786,040 C547F possibly damaging Het
Nek3 A T 8: 22,132,137 W363R probably damaging Het
Nphs1 T A 7: 30,467,520 Y717* probably null Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr167 T A 16: 19,515,232 M135L possibly damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Olfr508 T A 7: 108,630,907 M305K probably benign Het
Olfr824 G A 10: 130,126,718 T113I probably damaging Het
Optc T C 1: 133,898,349 H270R probably damaging Het
Pik3c2g A G 6: 139,635,610 probably benign Het
Pms1 A T 1: 53,267,789 probably null Het
Prkg1 T C 19: 31,585,578 Y156C probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Slc22a28 T A 19: 8,101,413 H304L probably benign Het
Stox1 C T 10: 62,666,031 C250Y probably benign Het
Sult2a3 A G 7: 14,121,737 W65R possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Syne2 C A 12: 76,035,624 T4857K probably damaging Het
Tcp1 T C 17: 12,918,083 L64S probably benign Het
Thap11 G T 8: 105,855,916 E186* probably null Het
Tmem67 A G 4: 12,040,633 probably null Het
Trappc10 T C 10: 78,210,382 Y458C probably damaging Het
Ufd1 A G 16: 18,825,778 Y197C possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp49 A G 17: 47,674,749 T245A probably damaging Het
Washc1 A T 17: 66,117,161 E289D probably benign Het
Zc3h7a A T 16: 11,151,147 V450E probably benign Het
Zcchc17 T G 4: 130,329,625 I123L possibly damaging Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Emsy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Emsy APN 7 98593455 missense probably benign 0.09
IGL01357:Emsy APN 7 98590870 nonsense probably null
IGL01620:Emsy APN 7 98626624 missense probably damaging 1.00
IGL01750:Emsy APN 7 98619301 missense probably damaging 0.99
IGL02032:Emsy APN 7 98590780 missense possibly damaging 0.94
IGL02388:Emsy APN 7 98641666 missense probably damaging 0.99
IGL03089:Emsy APN 7 98637266 nonsense probably null
IGL03272:Emsy APN 7 98593762 missense probably damaging 0.98
IGL03347:Emsy APN 7 98610685 missense probably damaging 0.99
IGL03400:Emsy APN 7 98602726 missense possibly damaging 0.94
IGL02980:Emsy UTSW 7 98619380 missense probably damaging 0.97
R0576:Emsy UTSW 7 98593776 missense probably damaging 0.99
R1102:Emsy UTSW 7 98602589 missense probably damaging 0.97
R1323:Emsy UTSW 7 98610657 splice site probably benign
R1438:Emsy UTSW 7 98621406 missense possibly damaging 0.88
R1439:Emsy UTSW 7 98600841 intron probably benign
R1452:Emsy UTSW 7 98600674 missense probably damaging 0.96
R1515:Emsy UTSW 7 98590856 missense probably damaging 1.00
R1535:Emsy UTSW 7 98593737 missense possibly damaging 0.94
R1791:Emsy UTSW 7 98647880 missense probably damaging 0.99
R1829:Emsy UTSW 7 98602729 missense possibly damaging 0.95
R1829:Emsy UTSW 7 98602730 missense possibly damaging 0.88
R1848:Emsy UTSW 7 98600821 missense probably damaging 0.99
R1861:Emsy UTSW 7 98641615 missense probably damaging 1.00
R1929:Emsy UTSW 7 98626623 missense probably damaging 0.99
R1957:Emsy UTSW 7 98647820 missense probably damaging 1.00
R2221:Emsy UTSW 7 98590775 missense possibly damaging 0.83
R2223:Emsy UTSW 7 98590775 missense possibly damaging 0.83
R2271:Emsy UTSW 7 98626623 missense probably damaging 0.99
R4707:Emsy UTSW 7 98597104 missense possibly damaging 0.94
R4783:Emsy UTSW 7 98646479 missense possibly damaging 0.74
R5453:Emsy UTSW 7 98600806 missense probably damaging 0.97
R5518:Emsy UTSW 7 98593611 missense possibly damaging 0.86
R5828:Emsy UTSW 7 98593492 missense probably benign
R5945:Emsy UTSW 7 98619383 missense probably damaging 0.97
R6153:Emsy UTSW 7 98610853 missense probably damaging 1.00
R6824:Emsy UTSW 7 98593407 missense probably benign 0.27
R7068:Emsy UTSW 7 98610761 missense probably benign 0.17
R7381:Emsy UTSW 7 98590803 missense probably damaging 0.98
R7417:Emsy UTSW 7 98615486 missense probably damaging 1.00
R7488:Emsy UTSW 7 98615555 missense possibly damaging 0.94
R7499:Emsy UTSW 7 98630331 missense possibly damaging 0.59
R7646:Emsy UTSW 7 98619353 missense probably damaging 1.00
R7682:Emsy UTSW 7 98590698 missense probably damaging 0.99
R7716:Emsy UTSW 7 98599766 missense unknown
R7789:Emsy UTSW 7 98621489 missense probably damaging 1.00
R7794:Emsy UTSW 7 98600724 missense probably benign 0.30
R7832:Emsy UTSW 7 98639853 missense probably damaging 1.00
R7974:Emsy UTSW 7 98630218 missense possibly damaging 0.73
R7996:Emsy UTSW 7 98593681 missense probably benign 0.00
R8070:Emsy UTSW 7 98626715 missense possibly damaging 0.73
R8221:Emsy UTSW 7 98647904 missense probably damaging 1.00
X0067:Emsy UTSW 7 98630240 missense possibly damaging 0.65
Z1088:Emsy UTSW 7 98600722 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTAGGTCCCCAGCCTAAATATGAG -3'
(R):5'- AGGACACAGTCTCCTCTTGG -3'

Sequencing Primer
(F):5'- CAGCCTAAATATGAGCAAAGTGC -3'
(R):5'- TGGCTTTTCCACTATAAACATTCTC -3'
Posted On2015-05-15