Incidental Mutation 'R4078:Syce1'
ID316692
Institutional Source Beutler Lab
Gene Symbol Syce1
Ensembl Gene ENSMUSG00000025480
Gene Namesynaptonemal complex central element protein 1
Synonyms4933406J07Rik
MMRRC Submission 041623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4078 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140777229-140787852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 140779896 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 83 (L83F)
Ref Sequence ENSEMBL: ENSMUSP00000148137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000026553] [ENSMUST00000209253] [ENSMUST00000211616]
Predicted Effect probably benign
Transcript: ENSMUST00000026552
SMART Domains Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479

DomainStartEndE-ValueType
transmembrane domain 2 23 N/A INTRINSIC
Pfam:p450 33 489 1.4e-147 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000026553
AA Change: L104F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026553
Gene: ENSMUSG00000025480
AA Change: L104F

DomainStartEndE-ValueType
Pfam:SYCE1 49 200 5.5e-66 PFAM
coiled coil region 237 294 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204061
Predicted Effect probably benign
Transcript: ENSMUST00000209253
Predicted Effect probably damaging
Transcript: ENSMUST00000211616
AA Change: L83F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1033 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptonemal complex, which links homologous chromosomes during prophase I of meiosis. The tripartite structure of the complex is highly conserved amongst metazoans. It consists of two lateral elements and a central region formed by transverse elements and a central element. The protein encoded by this gene localizes to the central element and is required for initiation and elongation of the synapsis. Allelic variants of this gene have been associated with premature ovarian failure and spermatogenic failure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit small ovaries and small testes, severe defects in gametogenesis, and infertility in both sexes. Meiosis is arrested, homologous chromosomes fail to synapse, and meiotic double-strand breaks are formed but are notefficiently repaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,061 L367* probably null Het
Agfg1 T A 1: 82,882,287 S312T possibly damaging Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Ambp T A 4: 63,150,443 K112N probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Asah1 A G 8: 41,354,082 S102P probably damaging Het
Atp10b T C 11: 43,153,283 V112A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cabs1 G A 5: 87,980,302 E271K probably damaging Het
Car8 T C 4: 8,169,731 K259R possibly damaging Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdh4 A G 2: 179,889,173 E616G possibly damaging Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cfap74 A G 4: 155,455,671 D975G probably damaging Het
Col27a1 G T 4: 63,224,432 R119L probably damaging Het
Col7a1 A G 9: 108,960,991 N918S unknown Het
Colec11 T C 12: 28,595,247 N142D possibly damaging Het
Cox7a2 G A 9: 79,758,570 Q10* probably null Het
Cyp2b23 C A 7: 26,673,092 G366V probably damaging Het
Emsy G A 7: 98,590,725 P1108S probably damaging Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
Fam151a G A 4: 106,747,757 G439S probably benign Het
Fat1 C T 8: 44,989,122 P1154S probably damaging Het
Fat4 G A 3: 38,980,020 S2607N probably damaging Het
Fzd7 T A 1: 59,483,789 M277K possibly damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10436 T A 12: 88,175,913 I312F probably benign Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm38706 G T 6: 130,483,737 noncoding transcript Het
Gm9758 T A 5: 14,911,522 probably null Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Heatr9 C A 11: 83,512,428 K428N probably benign Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kcnn3 A G 3: 89,661,188 K591R possibly damaging Het
Khdrbs2 T C 1: 32,519,814 probably benign Het
Lpp G A 16: 24,681,861 R141H probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mipep T A 14: 60,846,477 Y606N probably damaging Het
Mroh5 C A 15: 73,786,040 C547F possibly damaging Het
Nek3 A T 8: 22,132,137 W363R probably damaging Het
Nphs1 T A 7: 30,467,520 Y717* probably null Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr167 T A 16: 19,515,232 M135L possibly damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Olfr508 T A 7: 108,630,907 M305K probably benign Het
Olfr824 G A 10: 130,126,718 T113I probably damaging Het
Optc T C 1: 133,898,349 H270R probably damaging Het
Pik3c2g A G 6: 139,635,610 probably benign Het
Pms1 A T 1: 53,267,789 probably null Het
Prkg1 T C 19: 31,585,578 Y156C probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Slc22a28 T A 19: 8,101,413 H304L probably benign Het
Stox1 C T 10: 62,666,031 C250Y probably benign Het
Sult2a3 A G 7: 14,121,737 W65R possibly damaging Het
Syne2 C A 12: 76,035,624 T4857K probably damaging Het
Tcp1 T C 17: 12,918,083 L64S probably benign Het
Thap11 G T 8: 105,855,916 E186* probably null Het
Tmem67 A G 4: 12,040,633 probably null Het
Trappc10 T C 10: 78,210,382 Y458C probably damaging Het
Ufd1 A G 16: 18,825,778 Y197C possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp49 A G 17: 47,674,749 T245A probably damaging Het
Washc1 A T 17: 66,117,161 E289D probably benign Het
Zc3h7a A T 16: 11,151,147 V450E probably benign Het
Zcchc17 T G 4: 130,329,625 I123L possibly damaging Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Syce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02112:Syce1 APN 7 140779632 missense probably benign
IGL03304:Syce1 APN 7 140777710 missense possibly damaging 0.67
R0918:Syce1 UTSW 7 140780523 missense probably damaging 1.00
R1106:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R1169:Syce1 UTSW 7 140778207 missense probably benign 0.00
R1430:Syce1 UTSW 7 140779438 unclassified probably benign
R1436:Syce1 UTSW 7 140777680 missense possibly damaging 0.84
R1650:Syce1 UTSW 7 140778387 missense possibly damaging 0.62
R2081:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R2082:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R3890:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R3891:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4006:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4007:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4077:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4079:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4817:Syce1 UTSW 7 140778423 missense probably benign 0.00
R4824:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R5040:Syce1 UTSW 7 140779065 missense probably damaging 1.00
R5766:Syce1 UTSW 7 140777981 missense probably damaging 1.00
R6380:Syce1 UTSW 7 140779065 missense probably damaging 1.00
R7048:Syce1 UTSW 7 140779368 missense possibly damaging 0.73
Y4338:Syce1 UTSW 7 140779896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGTGCTTGCTAAGGC -3'
(R):5'- ACAGGAATGTGGATACCCGTAG -3'

Sequencing Primer
(F):5'- ACATATCACATCAAGTCTGTGGAC -3'
(R):5'- CGTAGGGGTAGGAACTTACCTC -3'
Posted On2015-05-15