Incidental Mutation 'R4078:Nek3'
ID316693
Institutional Source Beutler Lab
Gene Symbol Nek3
Ensembl Gene ENSMUSG00000031478
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 3
Synonyms
MMRRC Submission 041623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4078 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22128283-22166435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22132137 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 363 (W363R)
Ref Sequence ENSEMBL: ENSMUSP00000136876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033865] [ENSMUST00000110730] [ENSMUST00000178324]
Predicted Effect probably damaging
Transcript: ENSMUST00000033865
AA Change: W361R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033865
Gene: ENSMUSG00000031478
AA Change: W361R

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 444 8e-49 BLAST
low complexity region 471 485 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110730
AA Change: W363R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106358
Gene: ENSMUSG00000031478
AA Change: W363R

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151371
Predicted Effect probably damaging
Transcript: ENSMUST00000178324
AA Change: W363R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136876
Gene: ENSMUSG00000031478
AA Change: W363R

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,061 L367* probably null Het
Agfg1 T A 1: 82,882,287 S312T possibly damaging Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Ambp T A 4: 63,150,443 K112N probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Asah1 A G 8: 41,354,082 S102P probably damaging Het
Atp10b T C 11: 43,153,283 V112A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cabs1 G A 5: 87,980,302 E271K probably damaging Het
Car8 T C 4: 8,169,731 K259R possibly damaging Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdh4 A G 2: 179,889,173 E616G possibly damaging Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cfap74 A G 4: 155,455,671 D975G probably damaging Het
Col27a1 G T 4: 63,224,432 R119L probably damaging Het
Col7a1 A G 9: 108,960,991 N918S unknown Het
Colec11 T C 12: 28,595,247 N142D possibly damaging Het
Cox7a2 G A 9: 79,758,570 Q10* probably null Het
Cyp2b23 C A 7: 26,673,092 G366V probably damaging Het
Emsy G A 7: 98,590,725 P1108S probably damaging Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
Fam151a G A 4: 106,747,757 G439S probably benign Het
Fat1 C T 8: 44,989,122 P1154S probably damaging Het
Fat4 G A 3: 38,980,020 S2607N probably damaging Het
Fzd7 T A 1: 59,483,789 M277K possibly damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10436 T A 12: 88,175,913 I312F probably benign Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm38706 G T 6: 130,483,737 noncoding transcript Het
Gm9758 T A 5: 14,911,522 probably null Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Heatr9 C A 11: 83,512,428 K428N probably benign Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kcnn3 A G 3: 89,661,188 K591R possibly damaging Het
Khdrbs2 T C 1: 32,519,814 probably benign Het
Lpp G A 16: 24,681,861 R141H probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mipep T A 14: 60,846,477 Y606N probably damaging Het
Mroh5 C A 15: 73,786,040 C547F possibly damaging Het
Nphs1 T A 7: 30,467,520 Y717* probably null Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr167 T A 16: 19,515,232 M135L possibly damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Olfr508 T A 7: 108,630,907 M305K probably benign Het
Olfr824 G A 10: 130,126,718 T113I probably damaging Het
Optc T C 1: 133,898,349 H270R probably damaging Het
Pik3c2g A G 6: 139,635,610 probably benign Het
Pms1 A T 1: 53,267,789 probably null Het
Prkg1 T C 19: 31,585,578 Y156C probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Slc22a28 T A 19: 8,101,413 H304L probably benign Het
Stox1 C T 10: 62,666,031 C250Y probably benign Het
Sult2a3 A G 7: 14,121,737 W65R possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Syne2 C A 12: 76,035,624 T4857K probably damaging Het
Tcp1 T C 17: 12,918,083 L64S probably benign Het
Thap11 G T 8: 105,855,916 E186* probably null Het
Tmem67 A G 4: 12,040,633 probably null Het
Trappc10 T C 10: 78,210,382 Y458C probably damaging Het
Ufd1 A G 16: 18,825,778 Y197C possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp49 A G 17: 47,674,749 T245A probably damaging Het
Washc1 A T 17: 66,117,161 E289D probably benign Het
Zc3h7a A T 16: 11,151,147 V450E probably benign Het
Zcchc17 T G 4: 130,329,625 I123L possibly damaging Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Nek3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Nek3 APN 8 22158706 missense probably damaging 1.00
IGL01561:Nek3 APN 8 22129456 missense probably damaging 0.97
IGL02799:Nek3 APN 8 22158719 splice site probably benign
IGL02826:Nek3 APN 8 22160368 critical splice donor site probably null
R0001:Nek3 UTSW 8 22158612 splice site probably benign
R0390:Nek3 UTSW 8 22128729 unclassified probably benign
R1367:Nek3 UTSW 8 22160361 splice site probably benign
R1565:Nek3 UTSW 8 22132201 critical splice acceptor site probably null
R1758:Nek3 UTSW 8 22160262 missense probably damaging 1.00
R1924:Nek3 UTSW 8 22157031 missense probably damaging 1.00
R3905:Nek3 UTSW 8 22133091 missense probably benign 0.01
R4089:Nek3 UTSW 8 22149913 missense probably damaging 1.00
R4621:Nek3 UTSW 8 22157039 missense probably damaging 1.00
R5207:Nek3 UTSW 8 22132227 intron probably benign
R5432:Nek3 UTSW 8 22148732 intron probably null
R5790:Nek3 UTSW 8 22131297 missense probably damaging 1.00
R5790:Nek3 UTSW 8 22131298 missense probably damaging 1.00
R6856:Nek3 UTSW 8 22129447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCAGAGTTTTGGATCTAGG -3'
(R):5'- ACTCGGGCTACAAGAAATGC -3'

Sequencing Primer
(F):5'- CAATGCAGCTGTGGTAACTC -3'
(R):5'- CTCGGGCTACAAGAAATGCTTCTG -3'
Posted On2015-05-15