Incidental Mutation 'R4078:Usp49'
ID 316722
Institutional Source Beutler Lab
Gene Symbol Usp49
Ensembl Gene ENSMUSG00000090115
Gene Name ubiquitin specific peptidase 49
Synonyms
MMRRC Submission 041623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock # R4078 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 47630690-47686738 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47674749 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 245 (T245A)
Ref Sequence ENSEMBL: ENSMUSP00000120034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024779] [ENSMUST00000132397] [ENSMUST00000145314] [ENSMUST00000152724]
AlphaFold Q6P9L4
Predicted Effect probably damaging
Transcript: ENSMUST00000024779
AA Change: T461A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024779
Gene: ENSMUSG00000090115
AA Change: T461A

DomainStartEndE-ValueType
ZnF_UBP 25 74 4.21e-17 SMART
coiled coil region 165 203 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
Pfam:UCH 249 651 5.4e-61 PFAM
Pfam:UCH_1 337 633 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131550
Predicted Effect probably benign
Transcript: ENSMUST00000132397
SMART Domains Protein: ENSMUSP00000117658
Gene: ENSMUSG00000023984

DomainStartEndE-ValueType
Pfam:Med20 1 149 1.6e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145314
Predicted Effect probably damaging
Transcript: ENSMUST00000152724
AA Change: T245A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120034
Gene: ENSMUSG00000090115
AA Change: T245A

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:UCH 33 374 2.5e-40 PFAM
Pfam:UCH_1 119 374 1.5e-10 PFAM
Meta Mutation Damage Score 0.3770 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,061 L367* probably null Het
Agfg1 T A 1: 82,882,287 S312T possibly damaging Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Ambp T A 4: 63,150,443 K112N probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Asah1 A G 8: 41,354,082 S102P probably damaging Het
Atp10b T C 11: 43,153,283 V112A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cabs1 G A 5: 87,980,302 E271K probably damaging Het
Car8 T C 4: 8,169,731 K259R possibly damaging Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdh4 A G 2: 179,889,173 E616G possibly damaging Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cfap74 A G 4: 155,455,671 D975G probably damaging Het
Col27a1 G T 4: 63,224,432 R119L probably damaging Het
Col7a1 A G 9: 108,960,991 N918S unknown Het
Colec11 T C 12: 28,595,247 N142D possibly damaging Het
Cox7a2 G A 9: 79,758,570 Q10* probably null Het
Cyp2b23 C A 7: 26,673,092 G366V probably damaging Het
Emsy G A 7: 98,590,725 P1108S probably damaging Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
Fam151a G A 4: 106,747,757 G439S probably benign Het
Fat1 C T 8: 44,989,122 P1154S probably damaging Het
Fat4 G A 3: 38,980,020 S2607N probably damaging Het
Fzd7 T A 1: 59,483,789 M277K possibly damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10436 T A 12: 88,175,913 I312F probably benign Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm38706 G T 6: 130,483,737 noncoding transcript Het
Gm9758 T A 5: 14,911,522 probably null Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Heatr9 C A 11: 83,512,428 K428N probably benign Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kcnn3 A G 3: 89,661,188 K591R possibly damaging Het
Khdrbs2 T C 1: 32,519,814 probably benign Het
Lpp G A 16: 24,681,861 R141H probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mipep T A 14: 60,846,477 Y606N probably damaging Het
Mroh5 C A 15: 73,786,040 C547F possibly damaging Het
Nek3 A T 8: 22,132,137 W363R probably damaging Het
Nphs1 T A 7: 30,467,520 Y717* probably null Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr167 T A 16: 19,515,232 M135L possibly damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Olfr508 T A 7: 108,630,907 M305K probably benign Het
Olfr824 G A 10: 130,126,718 T113I probably damaging Het
Optc T C 1: 133,898,349 H270R probably damaging Het
Pik3c2g A G 6: 139,635,610 probably benign Het
Pms1 A T 1: 53,267,789 probably null Het
Prkg1 T C 19: 31,585,578 Y156C probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Slc22a28 T A 19: 8,101,413 H304L probably benign Het
Stox1 C T 10: 62,666,031 C250Y probably benign Het
Sult2a3 A G 7: 14,121,737 W65R possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Syne2 C A 12: 76,035,624 T4857K probably damaging Het
Tcp1 T C 17: 12,918,083 L64S probably benign Het
Thap11 G T 8: 105,855,916 E186* probably null Het
Tmem67 A G 4: 12,040,633 probably null Het
Trappc10 T C 10: 78,210,382 Y458C probably damaging Het
Ufd1 A G 16: 18,825,778 Y197C possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Washc1 A T 17: 66,117,161 E289D probably benign Het
Zc3h7a A T 16: 11,151,147 V450E probably benign Het
Zcchc17 T G 4: 130,329,625 I123L possibly damaging Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Usp49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00721:Usp49 APN 17 47680703 missense probably damaging 1.00
R0605:Usp49 UTSW 17 47674926 splice site probably null
R0919:Usp49 UTSW 17 47672451 missense probably benign 0.17
R1167:Usp49 UTSW 17 47672226 missense possibly damaging 0.94
R1675:Usp49 UTSW 17 47673410 missense probably damaging 1.00
R1733:Usp49 UTSW 17 47672313 missense probably damaging 1.00
R2344:Usp49 UTSW 17 47672903 missense probably damaging 1.00
R3737:Usp49 UTSW 17 47672318 missense probably damaging 1.00
R5079:Usp49 UTSW 17 47673221 missense possibly damaging 0.77
R6197:Usp49 UTSW 17 47673347 missense possibly damaging 0.66
R6244:Usp49 UTSW 17 47672902 nonsense probably null
R6303:Usp49 UTSW 17 47680822 missense probably damaging 0.98
R6536:Usp49 UTSW 17 47679692 missense probably damaging 1.00
R7207:Usp49 UTSW 17 47678877 missense probably benign 0.06
R7304:Usp49 UTSW 17 47672871 missense possibly damaging 0.78
R7418:Usp49 UTSW 17 47672168 nonsense probably null
R7508:Usp49 UTSW 17 47672280 missense probably benign 0.44
R7648:Usp49 UTSW 17 47674828 missense possibly damaging 0.93
R7705:Usp49 UTSW 17 47678948 missense probably damaging 1.00
R8529:Usp49 UTSW 17 47672112 missense probably damaging 0.98
R9081:Usp49 UTSW 17 47673311 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGTGGTTCCTCAGTTACAGC -3'
(R):5'- TACACTGGTCACAAGCGTAG -3'

Sequencing Primer
(F):5'- CTCAGTTACAGCTAGTTACAGCATGG -3'
(R):5'- ACTGGTCACAAGCGTAGATTCTC -3'
Posted On 2015-05-15