Mutagenetix > Incidental Mutation

Incidental Mutation 'R4079:Cnga3'

316727

Institutional Source

Beutler Lab

Gene Symbol

Cnga3

Ensembl Gene

ENSMUSG00000026114

Gene Name

cyclic nucleotide gated channel alpha 3

Synonyms

CNG3

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4079 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

37214434-37263384 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37241865 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 47 (Q47L)

Ref Sequence

ENSEMBL: ENSMUSP00000142235 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027288] [ENSMUST00000191981] [ENSMUST00000194195] [ENSMUST00000195272]

AlphaFold

Q9JJZ8

Predicted Effect

probably benign
Transcript: ENSMUST00000027288

SMART Domains

Protein: ENSMUSP00000027288
Gene: ENSMUSG00000026114

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	109	351	1.3e-30	PFAM
cNMP	423	547	2.5e-28	SMART
PDB:3SWY\|C	567	610	2e-14	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000191981
AA Change: Q47L

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000194195

SMART Domains

Protein: ENSMUSP00000142075
Gene: ENSMUSG00000026114

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	146	340	1.3e-15	PFAM
cNMP	423	547	2.4e-28	SMART
PDB:3SWY\|C	567	610	2e-14	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000195272
AA Change: Q47L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142175
Gene: ENSMUSG00000026114
AA Change: Q47L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	184	378	1.5e-15	PFAM
cNMP	461	585	2.4e-28	SMART
PDB:3SWY\|C	605	648	3e-14	PDB

Meta Mutation Damage Score

0.1345

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclic nucleotide-gated cation channel protein family which is required for normal vision and olfactory signal transduction. Mutations in this gene are associated with achromatopsia (rod monochromacy) and color blindness. Two alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals experience progressive loss of cone photoreceptor cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Cnga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01636:Cnga3	APN	1	37260793	missense	possibly damaging	0.89
IGL01677:Cnga3	APN	1	37244918	nonsense	probably null
IGL02475:Cnga3	APN	1	37257991	critical splice acceptor site	probably null
IGL03145:Cnga3	APN	1	37261674	missense	probably damaging	1.00
R1557:Cnga3	UTSW	1	37260985	missense	probably damaging	1.00
R1622:Cnga3	UTSW	1	37244828	splice site	probably benign
R1678:Cnga3	UTSW	1	37261498	missense	possibly damaging	0.94
R1938:Cnga3	UTSW	1	37261873	missense	possibly damaging	0.95
R2968:Cnga3	UTSW	1	37261078	missense	probably damaging	1.00
R2969:Cnga3	UTSW	1	37261078	missense	probably damaging	1.00
R3406:Cnga3	UTSW	1	37262065	missense	probably benign	0.00
R3694:Cnga3	UTSW	1	37261740	missense	probably damaging	1.00
R4850:Cnga3	UTSW	1	37258006	nonsense	probably null
R4907:Cnga3	UTSW	1	37241942	critical splice donor site	probably null
R5802:Cnga3	UTSW	1	37260925	missense	probably damaging	0.98
R6135:Cnga3	UTSW	1	37232237	start gained	probably benign
R6586:Cnga3	UTSW	1	37261278	missense	probably damaging	0.99
R6997:Cnga3	UTSW	1	37244884	missense	probably benign	0.34
R7630:Cnga3	UTSW	1	37258046	missense	probably damaging	1.00
R7799:Cnga3	UTSW	1	37261771	missense	probably damaging	1.00
R8552:Cnga3	UTSW	1	37244979	missense	probably benign
R8859:Cnga3	UTSW	1	37260771	missense	possibly damaging	0.91
R8968:Cnga3	UTSW	1	37261379	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TCCGGGGTAAGATTTGCAGC -3'
(R):5'- AGAACAGAACTAGTCACTGTTAGG -3'

Sequencing Primer
(F):5'- TAAGATTTGCAGCAGACCCTG -3'
(R):5'- CAGAACTAGTCACTGTTAGGGGATTC -3'

Posted On

2015-05-15