Incidental Mutation 'R4079:Ptprv'
ID 316730
Institutional Source Beutler Lab
Gene Symbol Ptprv
Ensembl Gene ENSMUSG00000097993
Gene Name protein tyrosine phosphatase, receptor type, V
Synonyms OST, mOST-PTP, Esp, OST-PTP
MMRRC Submission 040976-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4079 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 135108497-135132594 bp(-) (GRCm38)
Type of Mutation exon
DNA Base Change (assembly) A to G at 135110430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000086432
SMART Domains Protein: ENSMUSP00000083623
Gene: ENSMUSG00000066885

DomainStartEndE-ValueType
PTPc_DSPc 1 97 7.6e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183317
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased resistance to diet-induced obesity, decreased circulating glucose levels, and decreased suseptibility to death induced by streptozotocin treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,353,680 probably null Het
Ankfy1 C A 11: 72,690,009 probably benign Het
Ap4b1 T A 3: 103,813,378 N121K probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Armc9 A T 1: 86,213,129 probably benign Het
Bnc1 T C 7: 81,973,760 E573G probably damaging Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cbfa2t3 A G 8: 122,647,695 probably null Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdc45 A T 16: 18,811,360 V19D probably damaging Het
Cfap57 C A 4: 118,598,997 S500I probably benign Het
Cnga3 A T 1: 37,241,865 Q47L possibly damaging Het
Corin T C 5: 72,503,883 D89G probably benign Het
Cox16 A T 12: 81,474,335 probably benign Het
Cyp2a4 A G 7: 26,307,366 N50S probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
F13b T A 1: 139,501,770 F9I unknown Het
Fcer1a C T 1: 173,225,353 C36Y probably damaging Het
Fcho2 A G 13: 98,755,612 V318A probably damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10354 A T 5: 14,977,649 L71Q probably damaging Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Kpna7 A G 5: 145,005,927 I83T possibly damaging Het
Llgl1 C A 11: 60,710,284 probably null Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Mfn1 T G 3: 32,542,849 L152W probably damaging Het
Mog A G 17: 37,012,410 F212S probably damaging Het
Mpeg1 A G 19: 12,462,270 N364S probably damaging Het
Mtmr3 C T 11: 4,491,057 R531Q probably damaging Het
Mx2 A G 16: 97,556,036 N443S probably damaging Het
Nfatc3 T C 8: 106,079,491 Y323H probably damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr1037 A G 2: 86,085,312 V155A possibly damaging Het
Olfr686 A T 7: 105,204,021 H107Q probably damaging Het
Patl1 C T 19: 11,931,630 A467V probably damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phax A G 18: 56,575,979 N183S possibly damaging Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptpru A T 4: 131,798,710 probably null Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Rasgrp1 A G 2: 117,285,029 S693P probably benign Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Serpina3a C T 12: 104,119,675 Q320* probably null Het
Slc12a1 A T 2: 125,200,623 N733I possibly damaging Het
Snap47 C T 11: 59,428,551 V254I probably benign Het
St6galnac2 A T 11: 116,681,898 L244Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tns1 G A 1: 73,995,308 R192C probably damaging Het
Trav6-3 T C 14: 53,430,080 L3P possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp32 T A 11: 85,039,229 Y574F probably damaging Het
Other mutations in Ptprv
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02449:Ptprv APN 1 135111336 exon noncoding transcript
R4077:Ptprv UTSW 1 135110430 exon noncoding transcript
R4229:Ptprv UTSW 1 135126207 unclassified noncoding transcript
R4433:Ptprv UTSW 1 135114570 exon noncoding transcript
R4624:Ptprv UTSW 1 135124131 exon noncoding transcript
R4975:Ptprv UTSW 1 135118848 exon noncoding transcript
R5023:Ptprv UTSW 1 135124506 unclassified noncoding transcript
R5099:Ptprv UTSW 1 135118854 exon noncoding transcript
R5260:Ptprv UTSW 1 135112260 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AACGTTGTATCCCGTGAGACTC -3'
(R):5'- AGTCAGCTACCCTTAGGTCC -3'

Sequencing Primer
(F):5'- ACTCACAGGAGGCGATGC -3'
(R):5'- TACCCTTAGGTCCAGGCAG -3'
Posted On 2015-05-15