Mutagenetix > Incidental Mutations

Incidental Mutation 'R4079:Fcer1a'

316732

Institutional Source

Beutler Lab

Gene Symbol

Fcer1a

Ensembl Gene

ENSMUSG00000005339

Gene Name

Fc receptor, IgE, high affinity I, alpha polypeptide

Synonyms

Fcr-5, Fce1a, FcERI

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R4079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

173221284-173227214 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 173225353 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 36 (C36Y)

Ref Sequence

ENSEMBL: ENSMUSP00000141932 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049706] [ENSMUST00000193017]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049706
AA Change: C92Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056882
Gene: ENSMUSG00000005339
AA Change: C92Y

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IG	34	108	1.08e-8	SMART
IG	116	193	1.37e-1	SMART
transmembrane domain	200	222	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000193017
AA Change: C36Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141932
Gene: ENSMUSG00000005339
AA Change: C36Y

Domain	Start	End	E-Value	Type
IG_like	9	52	4.8e-1	SMART
IG	60	137	5.7e-4	SMART
transmembrane domain	144	166	N/A	INTRINSIC

Meta Mutation Damage Score

0.9426

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The immunoglobulin epsilon receptor (IgE receptor) is the initiator of the allergic response. When two or more high-affinity IgE receptors are brought together by allergen-bound IgE molecules, mediators such as histamine that are responsible for allergy symptoms are released. This receptor is comprised of an alpha subunit, a beta subunit, and two gamma subunits. The protein encoded by this gene represents the alpha subunit. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mast cell physiology and altered susceptibility to type I hypersensitivity reaction. Mice homozygous for another knock-out allele display altered development of allergic airway inflammation and airway hyperresponsiveness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Fcer1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Fcer1a	APN	1	173222533	unclassified	probably benign
IGL02068:Fcer1a	APN	1	173225504	missense	probably damaging	1.00
IGL03116:Fcer1a	APN	1	173221561	nonsense	probably null
IGL03343:Fcer1a	APN	1	173225473	missense	possibly damaging	0.86
P0031:Fcer1a	UTSW	1	173225332	missense	probably benign	0.30
R1772:Fcer1a	UTSW	1	173225437	missense	probably benign	0.04
R2163:Fcer1a	UTSW	1	173222697	missense	probably damaging	1.00
R4618:Fcer1a	UTSW	1	173222641	missense	possibly damaging	0.90
R5092:Fcer1a	UTSW	1	173225455	missense	probably damaging	0.98
R6633:Fcer1a	UTSW	1	173226726	critical splice donor site	probably null
R6719:Fcer1a	UTSW	1	173222773	missense	possibly damaging	0.90
R7404:Fcer1a	UTSW	1	173221516	missense	probably damaging	0.99
R7756:Fcer1a	UTSW	1	173221575	missense	probably damaging	0.96
RF016:Fcer1a	UTSW	1	173225519	missense	possibly damaging	0.85
X0012:Fcer1a	UTSW	1	173221548	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGTGATATGCCCCAAATCTCC -3'
(R):5'- ATCTGTACTGACCTTGGACCC -3'

Sequencing Primer
(F):5'- CCTTTGTGGGGTTCAAACAAC -3'
(R):5'- GACCCACCATGGATTAGAATATTTAC -3'

Posted On

2015-05-15