Mutagenetix > Incidental Mutation

Incidental Mutation 'R4079:Olfr1037'

316733

Institutional Source

Beutler Lab

Gene Symbol

Olfr1037

Ensembl Gene

ENSMUSG00000075205

Gene Name

olfactory receptor 1037

Synonyms

MOR171-52, MOR256-34P, GA_x6K02T2Q125-47560740-47559775

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R4079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86084671-86087385 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86085312 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 155 (V155A)

Ref Sequence

ENSEMBL: ENSMUSP00000150319 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099911] [ENSMUST00000213333] [ENSMUST00000216020] [ENSMUST00000216886]

AlphaFold

Q7TR84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099911
AA Change: V155A

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000097495
Gene: ENSMUSG00000075205
AA Change: V155A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	1.8e-54	PFAM
Pfam:7tm_1	41	290	1.2e-19	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213333
AA Change: V155A

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216020
AA Change: V155A

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216886
AA Change: V155A

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Olfr1037

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01390:Olfr1037	APN	2	86085640	missense	probably benign	0.05
IGL02534:Olfr1037	APN	2	86085369	missense	probably damaging	1.00
IGL03204:Olfr1037	APN	2	86085671	nonsense	probably null
R0054:Olfr1037	UTSW	2	86085361	missense	probably benign	0.38
R0054:Olfr1037	UTSW	2	86085361	missense	probably benign	0.38
R0131:Olfr1037	UTSW	2	86085500	missense	probably damaging	1.00
R0131:Olfr1037	UTSW	2	86085500	missense	probably damaging	1.00
R0666:Olfr1037	UTSW	2	86085213	missense	probably benign	0.03
R0732:Olfr1037	UTSW	2	86085584	missense	probably benign	0.00
R1167:Olfr1037	UTSW	2	86085291	missense	probably benign	0.16
R1899:Olfr1037	UTSW	2	86085720	missense	probably benign
R3082:Olfr1037	UTSW	2	86085709	missense	probably benign
R3847:Olfr1037	UTSW	2	86085407	nonsense	probably null
R3848:Olfr1037	UTSW	2	86085407	nonsense	probably null
R4193:Olfr1037	UTSW	2	86085700	missense	probably benign	0.01
R4832:Olfr1037	UTSW	2	86084846	missense	probably benign	0.00
R5244:Olfr1037	UTSW	2	86084956	missense	probably damaging	1.00
R5643:Olfr1037	UTSW	2	86085159	missense	probably damaging	0.98
R5644:Olfr1037	UTSW	2	86085159	missense	probably damaging	0.98
R5974:Olfr1037	UTSW	2	86084881	missense	probably benign
R6136:Olfr1037	UTSW	2	86084901	missense	probably damaging	1.00
R6189:Olfr1037	UTSW	2	86084913	missense	possibly damaging	0.53
R6483:Olfr1037	UTSW	2	86085440	missense	probably benign	0.00
R6569:Olfr1037	UTSW	2	86085505	missense	possibly damaging	0.87
R6724:Olfr1037	UTSW	2	86085357	missense	possibly damaging	0.81
R6867:Olfr1037	UTSW	2	86085738	missense	possibly damaging	0.59
R7081:Olfr1037	UTSW	2	86085595	missense	probably damaging	1.00
R7207:Olfr1037	UTSW	2	86084815	missense	possibly damaging	0.93
R7436:Olfr1037	UTSW	2	86084907	missense	probably damaging	1.00
R8699:Olfr1037	UTSW	2	86085174	missense	probably damaging	0.98
R9347:Olfr1037	UTSW	2	86085567	missense	possibly damaging	0.78
R9798:Olfr1037	UTSW	2	86085262	missense	probably damaging	0.99
X0062:Olfr1037	UTSW	2	86085114	missense	probably damaging	1.00
Z1088:Olfr1037	UTSW	2	86084982	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCTTCCTTCTGTGGACTGG -3'
(R):5'- CCCCAAGTTTCTGGAGACTC -3'

Sequencing Primer
(F):5'- TGGACTGGATTCTTAAGATAGCAGCC -3'
(R):5'- ACAGAAGGTCTATATCTTTCTACGCC -3'

Posted On

2015-05-15