Incidental Mutation 'R4079:Ccdc18'
ID316745
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Namecoiled-coil domain containing 18
Synonyms4932411G06Rik, 1700021E15Rik
MMRRC Submission 040976-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4079 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108132875-108233628 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 108158528 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 270 (Q270*)
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677] [ENSMUST00000197718]
Predicted Effect probably null
Transcript: ENSMUST00000047677
AA Change: Q270*
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: Q270*

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195973
Predicted Effect probably benign
Transcript: ENSMUST00000197718
SMART Domains Protein: ENSMUSP00000142963
Gene: ENSMUSG00000056531

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199603
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,353,680 probably null Het
Ankfy1 C A 11: 72,690,009 probably benign Het
Ap4b1 T A 3: 103,813,378 N121K probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Armc9 A T 1: 86,213,129 probably benign Het
Bnc1 T C 7: 81,973,760 E573G probably damaging Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cbfa2t3 A G 8: 122,647,695 probably null Het
Cdc45 A T 16: 18,811,360 V19D probably damaging Het
Cfap57 C A 4: 118,598,997 S500I probably benign Het
Cnga3 A T 1: 37,241,865 Q47L possibly damaging Het
Corin T C 5: 72,503,883 D89G probably benign Het
Cox16 A T 12: 81,474,335 probably benign Het
Cyp2a4 A G 7: 26,307,366 N50S probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
F13b T A 1: 139,501,770 F9I unknown Het
Fcer1a C T 1: 173,225,353 C36Y probably damaging Het
Fcho2 A G 13: 98,755,612 V318A probably damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10354 A T 5: 14,977,649 L71Q probably damaging Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Kpna7 A G 5: 145,005,927 I83T possibly damaging Het
Llgl1 C A 11: 60,710,284 probably null Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Mfn1 T G 3: 32,542,849 L152W probably damaging Het
Mog A G 17: 37,012,410 F212S probably damaging Het
Mpeg1 A G 19: 12,462,270 N364S probably damaging Het
Mtmr3 C T 11: 4,491,057 R531Q probably damaging Het
Mx2 A G 16: 97,556,036 N443S probably damaging Het
Nfatc3 T C 8: 106,079,491 Y323H probably damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr1037 A G 2: 86,085,312 V155A possibly damaging Het
Olfr686 A T 7: 105,204,021 H107Q probably damaging Het
Patl1 C T 19: 11,931,630 A467V probably damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phax A G 18: 56,575,979 N183S possibly damaging Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptpru A T 4: 131,798,710 probably null Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Rasgrp1 A G 2: 117,285,029 S693P probably benign Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Serpina3a C T 12: 104,119,675 Q320* probably null Het
Slc12a1 A T 2: 125,200,623 N733I possibly damaging Het
Snap47 C T 11: 59,428,551 V254I probably benign Het
St6galnac2 A T 11: 116,681,898 L244Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tns1 G A 1: 73,995,308 R192C probably damaging Het
Trav6-3 T C 14: 53,430,080 L3P possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp32 T A 11: 85,039,229 Y574F probably damaging Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108180525 missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108180887 missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108202186 splice site probably benign
IGL01718:Ccdc18 APN 5 108201348 missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108202111 missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108148922 missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108136052 missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108171748 missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108135969 splice site probably benign
IGL02880:Ccdc18 APN 5 108135444 missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108228901 missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108212131 missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108158619 missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108161700 missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108173761 missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108173789 missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108174964 missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108180416 missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108135560 missense probably damaging 0.99
R0648:Ccdc18 UTSW 5 108174987 missense probably damaging 1.00
R0666:Ccdc18 UTSW 5 108163664 missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108202116 nonsense probably null
R1509:Ccdc18 UTSW 5 108188978 missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108191977 missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108212188 missense probably benign
R1663:Ccdc18 UTSW 5 108216090 missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108193802 missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108220837 missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108196042 missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108228995 missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108158528 nonsense probably null
R4244:Ccdc18 UTSW 5 108148972 nonsense probably null
R4409:Ccdc18 UTSW 5 108220842 nonsense probably null
R4428:Ccdc18 UTSW 5 108136077 missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108161529 missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108228960 missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108135441 missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108136141 missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108192003 missense probably benign
R5039:Ccdc18 UTSW 5 108158648 critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108140874 missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108206728 missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108163759 missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108171618 missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108174887 missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108161582 missense probably benign
R6359:Ccdc18 UTSW 5 108135525 missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108174954 missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108201348 missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108161746 missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108191924 missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108138930 missense probably benign
R6664:Ccdc18 UTSW 5 108168100 nonsense probably null
R6836:Ccdc18 UTSW 5 108197967 missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108161535 missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108173862 critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108161688 missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108193798 missense probably benign
R7087:Ccdc18 UTSW 5 108196122 missense probably benign
R7117:Ccdc18 UTSW 5 108148969 missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108168106 missense probably benign
R7382:Ccdc18 UTSW 5 108139007 missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108220850 missense probably damaging 0.98
R7493:Ccdc18 UTSW 5 108206617 nonsense probably null
R7506:Ccdc18 UTSW 5 108163739 missense possibly damaging 0.85
R7635:Ccdc18 UTSW 5 108229049 critical splice donor site probably null
R7690:Ccdc18 UTSW 5 108228662 missense probably benign 0.00
R7748:Ccdc18 UTSW 5 108149041 critical splice donor site probably null
R7812:Ccdc18 UTSW 5 108180833 missense probably benign 0.00
R8019:Ccdc18 UTSW 5 108228645 nonsense probably null
RF013:Ccdc18 UTSW 5 108220716 missense probably benign 0.05
X0024:Ccdc18 UTSW 5 108191922 missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108212197 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGGCCCTTAAGCATTTCTG -3'
(R):5'- AGCCTTCTACATTACTAAACAGTCC -3'

Sequencing Primer
(F):5'- AAATAGTAACATCTTCCTCCCTGTC -3'
(R):5'- GTGGTTTTAAATGTTTCCTTTCTTCC -3'
Posted On2015-05-15