Mutagenetix > Incidental Mutations

Incidental Mutation 'R4079:Hnrnpul1'

316748

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpul1

Ensembl Gene

ENSMUSG00000040725

Gene Name

heterogeneous nuclear ribonucleoprotein U-like 1

Synonyms

E1B-AP5, E130317O14Rik, E1BAP5, Hnrpul1, Hnrnpul

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.613) question?

Stock #

R4079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25721165-25754757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 25726875 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 517 (R517Q)

Ref Sequence

ENSEMBL: ENSMUSP00000146263 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043765] [ENSMUST00000206832]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043765
AA Change: R417Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000037268
Gene: ENSMUSG00000040725
AA Change: R417Q

Domain	Start	End	E-Value	Type
SAP	3	37	2.86e-10	SMART
low complexity region	62	74	N/A	INTRINSIC
low complexity region	78	91	N/A	INTRINSIC
low complexity region	201	209	N/A	INTRINSIC
SPRY	255	388	8.49e-41	SMART
Pfam:AAA_33	424	569	1.4e-29	PFAM
low complexity region	613	626	N/A	INTRINSIC
low complexity region	631	693	N/A	INTRINSIC
low complexity region	695	718	N/A	INTRINSIC
low complexity region	745	765	N/A	INTRINSIC
low complexity region	768	859	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000206832
AA Change: R517Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.6851

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA-binding protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. This protein binds specifically to adenovirus early-1B-55kDa oncoprotein. It may play an important role in nucleocytoplasmic RNA transport, and its function is modulated by early-1B-55kDa in adenovirus-infected cells. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Hnrnpul1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Hnrnpul1	APN	7	25726154	missense	possibly damaging	0.74
IGL01287:Hnrnpul1	APN	7	25726898	missense	probably damaging	1.00
IGL01409:Hnrnpul1	APN	7	25724652	missense	unknown
IGL02026:Hnrnpul1	APN	7	25745162	missense	probably damaging	0.99
IGL02073:Hnrnpul1	APN	7	25722341	unclassified	probably benign
IGL02474:Hnrnpul1	APN	7	25726757	missense	probably benign	0.02
IGL02839:Hnrnpul1	APN	7	25733242	critical splice donor site	probably null
IGL02894:Hnrnpul1	APN	7	25750904	missense	possibly damaging	0.70
IGL03382:Hnrnpul1	APN	7	25750984	start codon destroyed	probably null	0.53
R0011:Hnrnpul1	UTSW	7	25742915	splice site	probably benign
R0525:Hnrnpul1	UTSW	7	25740883	missense	possibly damaging	0.72
R0587:Hnrnpul1	UTSW	7	25745232	missense	possibly damaging	0.70
R1121:Hnrnpul1	UTSW	7	25740907	missense	possibly damaging	0.68
R1313:Hnrnpul1	UTSW	7	25722916	unclassified	probably benign
R1313:Hnrnpul1	UTSW	7	25722916	unclassified	probably benign
R1880:Hnrnpul1	UTSW	7	25733098	missense	possibly damaging	0.95
R1892:Hnrnpul1	UTSW	7	25726766	missense	probably benign	0.11
R2113:Hnrnpul1	UTSW	7	25733269	missense	possibly damaging	0.47
R2194:Hnrnpul1	UTSW	7	25725922	critical splice donor site	probably null
R2269:Hnrnpul1	UTSW	7	25750874	missense	probably damaging	0.98
R2679:Hnrnpul1	UTSW	7	25726875	missense	probably damaging	1.00
R3079:Hnrnpul1	UTSW	7	25733115	nonsense	probably null
R3917:Hnrnpul1	UTSW	7	25726875	missense	probably damaging	1.00
R4077:Hnrnpul1	UTSW	7	25726875	missense	probably damaging	1.00
R4181:Hnrnpul1	UTSW	7	25726812	missense	probably damaging	0.98
R4449:Hnrnpul1	UTSW	7	25722284	unclassified	probably benign
R4707:Hnrnpul1	UTSW	7	25726833	missense	probably damaging	1.00
R4764:Hnrnpul1	UTSW	7	25743011	missense	probably benign	0.00
R5040:Hnrnpul1	UTSW	7	25742989	missense	possibly damaging	0.86
R5131:Hnrnpul1	UTSW	7	25726794	missense	probably benign	0.08
R5224:Hnrnpul1	UTSW	7	25745175	missense	probably damaging	0.98
R5599:Hnrnpul1	UTSW	7	25754672	start gained	probably benign
R5975:Hnrnpul1	UTSW	7	25754359	missense	possibly damaging	0.93
R7032:Hnrnpul1	UTSW	7	25750894	missense	probably benign	0.11
R7195:Hnrnpul1	UTSW	7	25724778	missense	unknown
R7231:Hnrnpul1	UTSW	7	25748417	nonsense	probably null
R7667:Hnrnpul1	UTSW	7	25754421	missense	probably damaging	0.99
R8060:Hnrnpul1	UTSW	7	25748343	missense	possibly damaging	0.54
Z1176:Hnrnpul1	UTSW	7	25724664	missense	probably benign	0.23
Z1176:Hnrnpul1	UTSW	7	25724698	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AAGATGCTGTTAAAATGGCCCC -3'
(R):5'- TTGGGAGCCAACCTCTTTG -3'

Sequencing Primer
(F):5'- GCTGTTAAAATGGCCCCCAACC -3'
(R):5'- CATTTGCTTAGATGGACATGAGTTC -3'

Posted On

2015-05-15