Mutagenetix > Incidental Mutation

Incidental Mutation 'R4079:Syce1'

316752

Institutional Source

Beutler Lab

Gene Symbol

Syce1

Ensembl Gene

ENSMUSG00000025480

Gene Name

synaptonemal complex central element protein 1

Synonyms

4933406J07Rik

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140777229-140787852 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 140779896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 83 (L83F)

Ref Sequence

ENSEMBL: ENSMUSP00000148137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000026553] [ENSMUST00000209253] [ENSMUST00000211616]

AlphaFold

Q9D495

Predicted Effect

probably benign
Transcript: ENSMUST00000026552

SMART Domains

Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479

Domain	Start	End	E-Value	Type
transmembrane domain	2	23	N/A	INTRINSIC
Pfam:p450	33	489	1.4e-147	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000026553
AA Change: L104F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026553
Gene: ENSMUSG00000025480
AA Change: L104F

Domain	Start	End	E-Value	Type
Pfam:SYCE1	49	200	5.5e-66	PFAM
coiled coil region	237	294	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204061

Predicted Effect

probably benign
Transcript: ENSMUST00000209253

Predicted Effect

probably damaging
Transcript: ENSMUST00000211616
AA Change: L83F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1033

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptonemal complex, which links homologous chromosomes during prophase I of meiosis. The tripartite structure of the complex is highly conserved amongst metazoans. It consists of two lateral elements and a central region formed by transverse elements and a central element. The protein encoded by this gene localizes to the central element and is required for initiation and elongation of the synapsis. Allelic variants of this gene have been associated with premature ovarian failure and spermatogenic failure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit small ovaries and small testes, severe defects in gametogenesis, and infertility in both sexes. Meiosis is arrested, homologous chromosomes fail to synapse, and meiotic double-strand breaks are formed but are notefficiently repaired. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Syce1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02112:Syce1	APN	7	140779632	missense	probably benign
IGL03304:Syce1	APN	7	140777710	missense	possibly damaging	0.67
R0918:Syce1	UTSW	7	140780523	missense	probably damaging	1.00
R1106:Syce1	UTSW	7	140779896	missense	probably damaging	1.00
R1169:Syce1	UTSW	7	140778207	missense	probably benign	0.00
R1430:Syce1	UTSW	7	140779438	unclassified	probably benign
R1436:Syce1	UTSW	7	140777680	missense	possibly damaging	0.84
R1650:Syce1	UTSW	7	140778387	missense	possibly damaging	0.62
R2081:Syce1	UTSW	7	140779896	missense	probably damaging	1.00
R2082:Syce1	UTSW	7	140779896	missense	probably damaging	1.00
R3890:Syce1	UTSW	7	140779896	missense	probably damaging	1.00
R3891:Syce1	UTSW	7	140779896	missense	probably damaging	1.00
R4006:Syce1	UTSW	7	140779896	missense	probably damaging	1.00
R4007:Syce1	UTSW	7	140779896	missense	probably damaging	1.00
R4077:Syce1	UTSW	7	140779896	missense	probably damaging	1.00
R4078:Syce1	UTSW	7	140779896	missense	probably damaging	1.00
R4817:Syce1	UTSW	7	140778423	missense	probably benign	0.00
R4824:Syce1	UTSW	7	140779896	missense	probably damaging	1.00
R5040:Syce1	UTSW	7	140779065	missense	probably damaging	1.00
R5766:Syce1	UTSW	7	140777981	missense	probably damaging	1.00
R6380:Syce1	UTSW	7	140779065	missense	probably damaging	1.00
R7048:Syce1	UTSW	7	140779368	missense	possibly damaging	0.73
R8681:Syce1	UTSW	7	140782074	missense	possibly damaging	0.58
Y4338:Syce1	UTSW	7	140779896	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTCTGTGGACACTTGATTGG -3'
(R):5'- CCAGTGGTTGTTGTACATGGAC -3'

Sequencing Primer
(F):5'- TGGACACTTGATTGGATTTTGAC -3'
(R):5'- TTTACAGGAATGTGGATACCCG -3'

Posted On

2015-05-15