Mutagenetix > Incidental Mutation

Incidental Mutation 'R4079:Scyl2'

316762

Institutional Source

Beutler Lab

Gene Symbol

Scyl2

Ensembl Gene

ENSMUSG00000069539

Gene Name

SCY1-like 2 (S. cerevisiae)

Synonyms

CVAK104, D10Ertd802e

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.235) question?

Stock #

R4079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89638721-89686285 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 89640596 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 889 (M889K)

Ref Sequence

ENSEMBL: ENSMUSP00000133992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092227] [ENSMUST00000174252]

AlphaFold

Q8CFE4

Predicted Effect

probably benign
Transcript: ENSMUST00000092227
AA Change: M888K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000089874
Gene: ENSMUSG00000069539
AA Change: M888K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	32	324	9.7e-15	PFAM
Pfam:Pkinase	32	327	4.6e-24	PFAM
low complexity region	356	369	N/A	INTRINSIC
low complexity region	679	704	N/A	INTRINSIC
low complexity region	896	921	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105294

Predicted Effect

probably benign
Transcript: ENSMUST00000174252
AA Change: M889K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000133992
Gene: ENSMUSG00000069539
AA Change: M889K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	32	324	6.4e-15	PFAM
Pfam:Pkinase	32	327	2.9e-26	PFAM
low complexity region	356	369	N/A	INTRINSIC
low complexity region	680	705	N/A	INTRINSIC
low complexity region	897	922	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with clathrin-coated complexes at the plasma membrane and with endocytic coated vesicles. The encoded protein phosphorylates the beta2 subunit of the plasma membrane adapter complex AP2 and interacts with clathrin, showing involvement in clathrin-dependent pathways between the trans-Golgi network and the endosomal system. In addition, this protein has a role in the Wnt signaling pathway by targeting frizzled 5 (Fzd5) for lysosomal degradation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, absent gastric milk in neonates, postnatal growth retardation, sensory-motor deficits and limb grapsing. Mice homozygous for a conditional allele exhibit similar phenotypes with near complete loss of CA3 neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Scyl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Scyl2	APN	10	89657809	critical splice donor site	probably null
IGL01141:Scyl2	APN	10	89640635	missense	probably benign
IGL01597:Scyl2	APN	10	89652987	missense	probably damaging	0.99
IGL01713:Scyl2	APN	10	89654225	missense	probably damaging	1.00
IGL02349:Scyl2	APN	10	89657938	splice site	probably benign
IGL02466:Scyl2	APN	10	89653009	nonsense	probably null
IGL02511:Scyl2	APN	10	89640819	missense	probably benign
IGL02949:Scyl2	APN	10	89660301	missense	possibly damaging	0.82
IGL03087:Scyl2	APN	10	89652968	missense	possibly damaging	0.93
IGL03117:Scyl2	APN	10	89657867	missense	possibly damaging	0.95
IGL03228:Scyl2	APN	10	89650080	missense	probably damaging	1.00
R0019:Scyl2	UTSW	10	89659321	missense	probably benign	0.44
R0827:Scyl2	UTSW	10	89657865	missense	possibly damaging	0.91
R1394:Scyl2	UTSW	10	89640965	missense	possibly damaging	0.59
R1460:Scyl2	UTSW	10	89657889	missense	possibly damaging	0.90
R1572:Scyl2	UTSW	10	89650956	missense	probably damaging	1.00
R1624:Scyl2	UTSW	10	89640736	missense	probably benign	0.19
R1909:Scyl2	UTSW	10	89640905	missense	probably benign	0.01
R3846:Scyl2	UTSW	10	89640541	missense	probably damaging	1.00
R4041:Scyl2	UTSW	10	89650052	missense	probably damaging	1.00
R4077:Scyl2	UTSW	10	89640596	missense	probably benign	0.01
R4765:Scyl2	UTSW	10	89659298	missense	probably damaging	0.97
R4855:Scyl2	UTSW	10	89640463	utr 3 prime	probably benign
R5308:Scyl2	UTSW	10	89642007	missense	probably benign	0.01
R5894:Scyl2	UTSW	10	89640819	missense	probably benign
R5901:Scyl2	UTSW	10	89660262	missense	probably benign	0.03
R6048:Scyl2	UTSW	10	89645486	missense	probably benign	0.33
R6249:Scyl2	UTSW	10	89657857	missense	possibly damaging	0.93
R6658:Scyl2	UTSW	10	89640973	missense	probably benign	0.01
R6827:Scyl2	UTSW	10	89669804	critical splice acceptor site	probably null
R6909:Scyl2	UTSW	10	89645742	missense	probably benign	0.28
R7027:Scyl2	UTSW	10	89645461	critical splice donor site	probably null
R7095:Scyl2	UTSW	10	89669687	missense	probably damaging	1.00
R8062:Scyl2	UTSW	10	89654160	missense	probably damaging	0.97
R8095:Scyl2	UTSW	10	89641103	missense	probably damaging	1.00
R8197:Scyl2	UTSW	10	89662366	missense	probably benign	0.33
R8232:Scyl2	UTSW	10	89662447	missense	probably damaging	1.00
R8241:Scyl2	UTSW	10	89654109	missense	possibly damaging	0.80
R8263:Scyl2	UTSW	10	89640663	missense	possibly damaging	0.50
R9020:Scyl2	UTSW	10	89652996	missense	probably damaging	1.00
R9748:Scyl2	UTSW	10	89640932	missense	probably benign	0.11
Z1177:Scyl2	UTSW	10	89669715	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCTTCAAGCCCGCTATACACTG -3'
(R):5'- GTGAAGCAGCCTCAACAGAG -3'

Sequencing Primer
(F):5'- CAGCTTTCTCATGATTGAAACTGCAG -3'
(R):5'- GAGACCAACCGATATGTCTGC -3'

Posted On

2015-05-15