Incidental Mutation 'R4079:Scyl2'
ID 316762
Institutional Source Beutler Lab
Gene Symbol Scyl2
Ensembl Gene ENSMUSG00000069539
Gene Name SCY1-like 2 (S. cerevisiae)
Synonyms CVAK104, D10Ertd802e
MMRRC Submission 040976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock # R4079 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 89638721-89686285 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89640596 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 889 (M889K)
Ref Sequence ENSEMBL: ENSMUSP00000133992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092227] [ENSMUST00000174252]
AlphaFold Q8CFE4
Predicted Effect probably benign
Transcript: ENSMUST00000092227
AA Change: M888K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000089874
Gene: ENSMUSG00000069539
AA Change: M888K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 9.7e-15 PFAM
Pfam:Pkinase 32 327 4.6e-24 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 679 704 N/A INTRINSIC
low complexity region 896 921 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105294
Predicted Effect probably benign
Transcript: ENSMUST00000174252
AA Change: M889K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133992
Gene: ENSMUSG00000069539
AA Change: M889K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 6.4e-15 PFAM
Pfam:Pkinase 32 327 2.9e-26 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 897 922 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with clathrin-coated complexes at the plasma membrane and with endocytic coated vesicles. The encoded protein phosphorylates the beta2 subunit of the plasma membrane adapter complex AP2 and interacts with clathrin, showing involvement in clathrin-dependent pathways between the trans-Golgi network and the endosomal system. In addition, this protein has a role in the Wnt signaling pathway by targeting frizzled 5 (Fzd5) for lysosomal degradation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, absent gastric milk in neonates, postnatal growth retardation, sensory-motor deficits and limb grapsing. Mice homozygous for a conditional allele exhibit similar phenotypes with near complete loss of CA3 neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,353,680 probably null Het
Ankfy1 C A 11: 72,690,009 probably benign Het
Ap4b1 T A 3: 103,813,378 N121K probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Armc9 A T 1: 86,213,129 probably benign Het
Bnc1 T C 7: 81,973,760 E573G probably damaging Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cbfa2t3 A G 8: 122,647,695 probably null Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdc45 A T 16: 18,811,360 V19D probably damaging Het
Cfap57 C A 4: 118,598,997 S500I probably benign Het
Cnga3 A T 1: 37,241,865 Q47L possibly damaging Het
Corin T C 5: 72,503,883 D89G probably benign Het
Cox16 A T 12: 81,474,335 probably benign Het
Cyp2a4 A G 7: 26,307,366 N50S probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
F13b T A 1: 139,501,770 F9I unknown Het
Fcer1a C T 1: 173,225,353 C36Y probably damaging Het
Fcho2 A G 13: 98,755,612 V318A probably damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10354 A T 5: 14,977,649 L71Q probably damaging Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Kpna7 A G 5: 145,005,927 I83T possibly damaging Het
Llgl1 C A 11: 60,710,284 probably null Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Mfn1 T G 3: 32,542,849 L152W probably damaging Het
Mog A G 17: 37,012,410 F212S probably damaging Het
Mpeg1 A G 19: 12,462,270 N364S probably damaging Het
Mtmr3 C T 11: 4,491,057 R531Q probably damaging Het
Mx2 A G 16: 97,556,036 N443S probably damaging Het
Nfatc3 T C 8: 106,079,491 Y323H probably damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr1037 A G 2: 86,085,312 V155A possibly damaging Het
Olfr686 A T 7: 105,204,021 H107Q probably damaging Het
Patl1 C T 19: 11,931,630 A467V probably damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phax A G 18: 56,575,979 N183S possibly damaging Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptpru A T 4: 131,798,710 probably null Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Rasgrp1 A G 2: 117,285,029 S693P probably benign Het
Serpina3a C T 12: 104,119,675 Q320* probably null Het
Slc12a1 A T 2: 125,200,623 N733I possibly damaging Het
Snap47 C T 11: 59,428,551 V254I probably benign Het
St6galnac2 A T 11: 116,681,898 L244Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tns1 G A 1: 73,995,308 R192C probably damaging Het
Trav6-3 T C 14: 53,430,080 L3P possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp32 T A 11: 85,039,229 Y574F probably damaging Het
Other mutations in Scyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Scyl2 APN 10 89657809 critical splice donor site probably null
IGL01141:Scyl2 APN 10 89640635 missense probably benign
IGL01597:Scyl2 APN 10 89652987 missense probably damaging 0.99
IGL01713:Scyl2 APN 10 89654225 missense probably damaging 1.00
IGL02349:Scyl2 APN 10 89657938 splice site probably benign
IGL02466:Scyl2 APN 10 89653009 nonsense probably null
IGL02511:Scyl2 APN 10 89640819 missense probably benign
IGL02949:Scyl2 APN 10 89660301 missense possibly damaging 0.82
IGL03087:Scyl2 APN 10 89652968 missense possibly damaging 0.93
IGL03117:Scyl2 APN 10 89657867 missense possibly damaging 0.95
IGL03228:Scyl2 APN 10 89650080 missense probably damaging 1.00
R0019:Scyl2 UTSW 10 89659321 missense probably benign 0.44
R0827:Scyl2 UTSW 10 89657865 missense possibly damaging 0.91
R1394:Scyl2 UTSW 10 89640965 missense possibly damaging 0.59
R1460:Scyl2 UTSW 10 89657889 missense possibly damaging 0.90
R1572:Scyl2 UTSW 10 89650956 missense probably damaging 1.00
R1624:Scyl2 UTSW 10 89640736 missense probably benign 0.19
R1909:Scyl2 UTSW 10 89640905 missense probably benign 0.01
R3846:Scyl2 UTSW 10 89640541 missense probably damaging 1.00
R4041:Scyl2 UTSW 10 89650052 missense probably damaging 1.00
R4077:Scyl2 UTSW 10 89640596 missense probably benign 0.01
R4765:Scyl2 UTSW 10 89659298 missense probably damaging 0.97
R4855:Scyl2 UTSW 10 89640463 utr 3 prime probably benign
R5308:Scyl2 UTSW 10 89642007 missense probably benign 0.01
R5894:Scyl2 UTSW 10 89640819 missense probably benign
R5901:Scyl2 UTSW 10 89660262 missense probably benign 0.03
R6048:Scyl2 UTSW 10 89645486 missense probably benign 0.33
R6249:Scyl2 UTSW 10 89657857 missense possibly damaging 0.93
R6658:Scyl2 UTSW 10 89640973 missense probably benign 0.01
R6827:Scyl2 UTSW 10 89669804 critical splice acceptor site probably null
R6909:Scyl2 UTSW 10 89645742 missense probably benign 0.28
R7027:Scyl2 UTSW 10 89645461 critical splice donor site probably null
R7095:Scyl2 UTSW 10 89669687 missense probably damaging 1.00
R8062:Scyl2 UTSW 10 89654160 missense probably damaging 0.97
R8095:Scyl2 UTSW 10 89641103 missense probably damaging 1.00
R8197:Scyl2 UTSW 10 89662366 missense probably benign 0.33
R8232:Scyl2 UTSW 10 89662447 missense probably damaging 1.00
R8241:Scyl2 UTSW 10 89654109 missense possibly damaging 0.80
R8263:Scyl2 UTSW 10 89640663 missense possibly damaging 0.50
R9020:Scyl2 UTSW 10 89652996 missense probably damaging 1.00
R9748:Scyl2 UTSW 10 89640932 missense probably benign 0.11
Z1177:Scyl2 UTSW 10 89669715 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTTCAAGCCCGCTATACACTG -3'
(R):5'- GTGAAGCAGCCTCAACAGAG -3'

Sequencing Primer
(F):5'- CAGCTTTCTCATGATTGAAACTGCAG -3'
(R):5'- GAGACCAACCGATATGTCTGC -3'
Posted On 2015-05-15