Mutagenetix > Incidental Mutations

Incidental Mutation 'R4079:Cadps'

316774

Institutional Source

Beutler Lab

Gene Symbol

Cadps

Ensembl Gene

ENSMUSG00000054423

Gene Name

Ca2+-dependent secretion activator

Synonyms

CAPS1

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12372563-12823079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 12457702 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 1060 (A1060T)

Ref Sequence

ENSEMBL: ENSMUSP00000064706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]

Predicted Effect

probably benign
Transcript: ENSMUST00000067491
AA Change: A1060T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: A1060T

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	772	783	N/A	INTRINSIC
DUF1041	833	948	6.21e-54	SMART
low complexity region	1022	1045	N/A	INTRINSIC
low complexity region	1354	1361	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112657
AA Change: A1053T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: A1053T

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	775	786	N/A	INTRINSIC
DUF1041	836	941	3.88e-55	SMART
low complexity region	1015	1038	N/A	INTRINSIC
low complexity region	1347	1354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112658
AA Change: A1054T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: A1054T

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	776	787	N/A	INTRINSIC
DUF1041	837	942	3.88e-55	SMART
low complexity region	1016	1039	N/A	INTRINSIC
low complexity region	1348	1355	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177814
AA Change: A1055T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: A1055T

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	777	788	N/A	INTRINSIC
DUF1041	838	943	2.75e-55	SMART
low complexity region	1017	1040	N/A	INTRINSIC
low complexity region	1349	1356	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224106

Predicted Effect

probably benign
Transcript: ENSMUST00000224581

Predicted Effect

probably benign
Transcript: ENSMUST00000224882

Meta Mutation Damage Score

0.0604

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Cadps

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Cadps	APN	14	12491795	missense	probably damaging	1.00
IGL00990:Cadps	APN	14	12715374	missense	possibly damaging	0.56
IGL01071:Cadps	APN	14	12509091	splice site	probably null
IGL01339:Cadps	APN	14	12486543	missense	possibly damaging	0.58
IGL01518:Cadps	APN	14	12522352	missense	probably damaging	1.00
IGL01560:Cadps	APN	14	12491792	missense	probably damaging	1.00
IGL01598:Cadps	APN	14	12522202	critical splice donor site	probably null
IGL01603:Cadps	APN	14	12454154	splice site	probably benign
IGL01836:Cadps	APN	14	12522311	missense	probably damaging	1.00
IGL01839:Cadps	APN	14	12467184	splice site	probably benign
IGL01932:Cadps	APN	14	12373609	utr 3 prime	probably benign
IGL02172:Cadps	APN	14	12705681	missense	probably damaging	1.00
IGL02175:Cadps	APN	14	12467092	missense	probably damaging	0.96
IGL02212:Cadps	APN	14	12522345	missense	possibly damaging	0.94
IGL02351:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02358:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02499:Cadps	APN	14	12822725	nonsense	probably null
IGL02505:Cadps	APN	14	12449759	missense	probably damaging	1.00
IGL02591:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02592:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02671:Cadps	APN	14	12491824	missense	probably damaging	1.00
IGL02956:Cadps	APN	14	12418047	splice site	probably benign
IGL03029:Cadps	APN	14	12376675	missense	probably damaging	1.00
IGL03216:Cadps	APN	14	12439944	missense	probably damaging	1.00
IGL03282:Cadps	APN	14	12465856	splice site	probably benign
turbo	UTSW	14	12491800	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0420:Cadps	UTSW	14	12491800	missense	probably damaging	1.00
R1180:Cadps	UTSW	14	12457836	splice site	probably benign
R1398:Cadps	UTSW	14	12449822	missense	probably damaging	1.00
R1678:Cadps	UTSW	14	12517802	critical splice donor site	probably null
R1792:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12505796	missense	probably benign	0.09
R1918:Cadps	UTSW	14	12546372	missense	probably damaging	0.99
R1920:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1921:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1922:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1925:Cadps	UTSW	14	12705726	missense	probably damaging	1.00
R1966:Cadps	UTSW	14	12822450	nonsense	probably null
R2013:Cadps	UTSW	14	12522337	missense	probably damaging	1.00
R2228:Cadps	UTSW	14	12465935	missense	probably benign	0.05
R2331:Cadps	UTSW	14	12603692	missense	probably damaging	1.00
R3436:Cadps	UTSW	14	12616158	splice site	probably null
R3853:Cadps	UTSW	14	12509090	splice site	probably benign
R3893:Cadps	UTSW	14	12488883	utr 3 prime	probably benign
R3916:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3917:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3953:Cadps	UTSW	14	12505937	missense	probably damaging	1.00
R3966:Cadps	UTSW	14	12522161	splice site	probably null
R4024:Cadps	UTSW	14	12705539	missense	probably damaging	1.00
R4230:Cadps	UTSW	14	12488987	missense	probably damaging	0.98
R4333:Cadps	UTSW	14	12467031	missense	probably damaging	1.00
R4410:Cadps	UTSW	14	12822323	missense	probably damaging	0.98
R4586:Cadps	UTSW	14	12505808	missense	probably damaging	1.00
R4685:Cadps	UTSW	14	12467139	missense	possibly damaging	0.77
R4698:Cadps	UTSW	14	12705654	missense	possibly damaging	0.90
R4855:Cadps	UTSW	14	12822449	missense	unknown
R4898:Cadps	UTSW	14	12411588	missense	possibly damaging	0.86
R4908:Cadps	UTSW	14	12536386	missense	probably damaging	1.00
R5208:Cadps	UTSW	14	12457711	missense	possibly damaging	0.68
R5297:Cadps	UTSW	14	12822345	missense	probably damaging	1.00
R5328:Cadps	UTSW	14	12457790	missense	probably benign	0.31
R5408:Cadps	UTSW	14	12705759	missense	possibly damaging	0.87
R5529:Cadps	UTSW	14	12454285	missense	probably damaging	1.00
R5567:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5570:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5727:Cadps	UTSW	14	12486525	nonsense	probably null
R5812:Cadps	UTSW	14	12376685	missense	probably benign
R6361:Cadps	UTSW	14	12491778	nonsense	probably null
R6767:Cadps	UTSW	14	12550888	missense	probably damaging	1.00
R6805:Cadps	UTSW	14	12467103	missense	probably damaging	0.99
R6861:Cadps	UTSW	14	12522401	nonsense	probably null
R6883:Cadps	UTSW	14	12465883	missense	probably damaging	0.96
R6887:Cadps	UTSW	14	12505811	missense	probably damaging	1.00
R6997:Cadps	UTSW	14	12505793	missense	possibly damaging	0.88
R7102:Cadps	UTSW	14	12603738	missense	probably damaging	1.00
R7120:Cadps	UTSW	14	12439919	missense	probably damaging	0.98
R7143:Cadps	UTSW	14	12491838	missense	probably benign	0.02
R7290:Cadps	UTSW	14	12616099	missense	probably damaging	1.00
R7614:Cadps	UTSW	14	12454260	missense	probably damaging	1.00
R7674:Cadps	UTSW	14	12411581	missense	probably damaging	0.99
R7715:Cadps	UTSW	14	12457762	missense	probably benign	0.01
R7801:Cadps	UTSW	14	12489476	critical splice donor site	probably null
R7814:Cadps	UTSW	14	12376706	missense	probably damaging	0.99
R7915:Cadps	UTSW	14	12705544	missense	possibly damaging	0.84
R8087:Cadps	UTSW	14	12536380	missense	probably damaging	1.00
R8109:Cadps	UTSW	14	12488975	missense	probably benign	0.00
X0018:Cadps	UTSW	14	12373690	missense	probably damaging	1.00
X0028:Cadps	UTSW	14	12467118	missense	possibly damaging	0.93
Z1088:Cadps	UTSW	14	12467113	missense	probably damaging	0.96
Z1177:Cadps	UTSW	14	12465880	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGTGTTAGACAAATCGTTACTGC -3'
(R):5'- CCGCATCTACATTGTCACTGTG -3'

Sequencing Primer
(F):5'- GTCTTATAAACACGATGAATGCCAG -3'
(R):5'- ACATTGTCACTGTGATGGTATTTTTC -3'

Posted On

2015-05-15