Incidental Mutation 'R4079:C3'
ID 316781
Institutional Source Beutler Lab
Gene Symbol C3
Ensembl Gene ENSMUSG00000024164
Gene Name complement component 3
Synonyms complement factor 3, acylation stimulating protein, Plp
MMRRC Submission 040976-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4079 (G1)
Quality Score 214
Status Validated
Chromosome 17
Chromosomal Location 57203970-57228136 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 57205303 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1542 (D1542N)
Ref Sequence ENSEMBL: ENSMUSP00000024988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]
AlphaFold P01027
Predicted Effect possibly damaging
Transcript: ENSMUST00000024988
AA Change: D1542N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: D1542N

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:A2M_N 130 225 3.8e-17 PFAM
A2M_N_2 456 604 5.22e-38 SMART
ANATO 693 728 5.69e-15 SMART
low complexity region 752 762 N/A INTRINSIC
A2M 770 866 5.47e-32 SMART
Pfam:Thiol-ester_cl 1000 1028 4.6e-15 PFAM
Pfam:A2M_comp 1051 1284 7.3e-60 PFAM
A2M_recep 1398 1493 3.98e-43 SMART
C345C 1533 1645 1.85e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177046
Predicted Effect probably benign
Transcript: ENSMUST00000177425
SMART Domains Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

DomainStartEndE-ValueType
Pfam:A2M_N_2 1 55 1.6e-10 PFAM
PDB:3L5N|B 74 102 1e-9 PDB
Meta Mutation Damage Score 0.1622 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,353,680 probably null Het
Ankfy1 C A 11: 72,690,009 probably benign Het
Ap4b1 T A 3: 103,813,378 N121K probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Armc9 A T 1: 86,213,129 probably benign Het
Bnc1 T C 7: 81,973,760 E573G probably damaging Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cbfa2t3 A G 8: 122,647,695 probably null Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdc45 A T 16: 18,811,360 V19D probably damaging Het
Cfap57 C A 4: 118,598,997 S500I probably benign Het
Cnga3 A T 1: 37,241,865 Q47L possibly damaging Het
Corin T C 5: 72,503,883 D89G probably benign Het
Cox16 A T 12: 81,474,335 probably benign Het
Cyp2a4 A G 7: 26,307,366 N50S probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
F13b T A 1: 139,501,770 F9I unknown Het
Fcer1a C T 1: 173,225,353 C36Y probably damaging Het
Fcho2 A G 13: 98,755,612 V318A probably damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10354 A T 5: 14,977,649 L71Q probably damaging Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Kpna7 A G 5: 145,005,927 I83T possibly damaging Het
Llgl1 C A 11: 60,710,284 probably null Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Mfn1 T G 3: 32,542,849 L152W probably damaging Het
Mog A G 17: 37,012,410 F212S probably damaging Het
Mpeg1 A G 19: 12,462,270 N364S probably damaging Het
Mtmr3 C T 11: 4,491,057 R531Q probably damaging Het
Mx2 A G 16: 97,556,036 N443S probably damaging Het
Nfatc3 T C 8: 106,079,491 Y323H probably damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr1037 A G 2: 86,085,312 V155A possibly damaging Het
Olfr686 A T 7: 105,204,021 H107Q probably damaging Het
Patl1 C T 19: 11,931,630 A467V probably damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phax A G 18: 56,575,979 N183S possibly damaging Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptpru A T 4: 131,798,710 probably null Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Rasgrp1 A G 2: 117,285,029 S693P probably benign Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Serpina3a C T 12: 104,119,675 Q320* probably null Het
Slc12a1 A T 2: 125,200,623 N733I possibly damaging Het
Snap47 C T 11: 59,428,551 V254I probably benign Het
St6galnac2 A T 11: 116,681,898 L244Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tns1 G A 1: 73,995,308 R192C probably damaging Het
Trav6-3 T C 14: 53,430,080 L3P possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp32 T A 11: 85,039,229 Y574F probably damaging Het
Other mutations in C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:C3 APN 17 57226004 missense probably benign 0.01
IGL00741:C3 APN 17 57220206 intron probably benign
IGL01093:C3 APN 17 57223949 missense probably damaging 1.00
IGL01309:C3 APN 17 57209652 intron probably benign
IGL01312:C3 APN 17 57225993 unclassified probably benign
IGL01344:C3 APN 17 57224880 missense probably benign
IGL01514:C3 APN 17 57215866 missense probably benign 0.04
IGL01913:C3 APN 17 57213767 missense probably null 0.01
IGL02165:C3 APN 17 57225092 missense probably benign 0.17
IGL02176:C3 APN 17 57226337 unclassified probably benign
IGL02189:C3 APN 17 57220113 missense probably benign 0.01
IGL02378:C3 APN 17 57212698 missense probably benign 0.19
IGL02422:C3 APN 17 57226823 missense probably damaging 0.98
IGL02715:C3 APN 17 57204158 intron probably benign
IGL02737:C3 APN 17 57204281 missense probably benign 0.08
IGL03201:C3 APN 17 57222249 missense probably damaging 1.00
IGL03210:C3 APN 17 57215846 nonsense probably null
IGL03345:C3 APN 17 57219585 missense probably damaging 1.00
PIT4431001:C3 UTSW 17 57206242 missense probably benign 0.00
PIT4494001:C3 UTSW 17 57209263 missense probably benign 0.01
R0158:C3 UTSW 17 57224851 critical splice donor site probably null
R0318:C3 UTSW 17 57224709 missense probably damaging 0.99
R1132:C3 UTSW 17 57207531 critical splice donor site probably null
R1765:C3 UTSW 17 57224401 splice site probably null
R1793:C3 UTSW 17 57219592 missense possibly damaging 0.93
R1852:C3 UTSW 17 57222823 missense probably damaging 0.98
R1908:C3 UTSW 17 57209489 missense probably damaging 1.00
R1919:C3 UTSW 17 57220135 missense probably damaging 1.00
R1935:C3 UTSW 17 57218829 missense probably damaging 1.00
R2026:C3 UTSW 17 57218562 missense probably damaging 1.00
R2108:C3 UTSW 17 57223974 splice site probably null
R2197:C3 UTSW 17 57219623 missense probably benign 0.32
R2394:C3 UTSW 17 57222303 nonsense probably null
R2998:C3 UTSW 17 57210284 missense probably benign 0.00
R3727:C3 UTSW 17 57207379 missense possibly damaging 0.50
R3767:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3768:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3769:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3770:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3784:C3 UTSW 17 57226067 missense probably damaging 0.99
R3883:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3884:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3950:C3 UTSW 17 57225286 missense probably benign 0.02
R3966:C3 UTSW 17 57218664 missense probably damaging 0.99
R4077:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4078:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4168:C3 UTSW 17 57218608 missense probably benign 0.00
R4208:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4695:C3 UTSW 17 57221057 missense probably benign
R4909:C3 UTSW 17 57226830 critical splice donor site probably null
R5011:C3 UTSW 17 57223236 missense probably benign 0.06
R5094:C3 UTSW 17 57225033 critical splice donor site probably null
R5141:C3 UTSW 17 57219570 missense probably damaging 0.98
R5170:C3 UTSW 17 57223938 missense probably damaging 0.96
R5339:C3 UTSW 17 57224308 missense probably damaging 0.99
R5369:C3 UTSW 17 57221159 missense probably benign 0.45
R5412:C3 UTSW 17 57220187 missense probably benign 0.01
R5439:C3 UTSW 17 57204502 missense probably benign 0.28
R5463:C3 UTSW 17 57211720 missense probably benign 0.08
R5546:C3 UTSW 17 57222976 missense probably damaging 0.99
R5572:C3 UTSW 17 57224673 missense probably damaging 0.99
R5851:C3 UTSW 17 57211612 missense probably null 0.14
R5863:C3 UTSW 17 57223141 missense probably benign 0.06
R5888:C3 UTSW 17 57214831 missense probably damaging 1.00
R5940:C3 UTSW 17 57210244 missense possibly damaging 0.64
R6073:C3 UTSW 17 57206223 missense probably null
R6091:C3 UTSW 17 57221967 nonsense probably null
R6286:C3 UTSW 17 57224118 missense probably damaging 1.00
R6524:C3 UTSW 17 57217264 critical splice donor site probably null
R6868:C3 UTSW 17 57204029 missense possibly damaging 0.55
R6896:C3 UTSW 17 57220864 splice site probably null
R7007:C3 UTSW 17 57218809 missense probably benign 0.00
R7022:C3 UTSW 17 57217286 missense probably damaging 1.00
R7099:C3 UTSW 17 57206276 missense probably benign 0.28
R7117:C3 UTSW 17 57212655 missense probably benign 0.01
R7347:C3 UTSW 17 57223215 missense probably benign 0.09
R7366:C3 UTSW 17 57221162 missense probably benign 0.00
R7423:C3 UTSW 17 57214767 missense probably damaging 1.00
R7425:C3 UTSW 17 57204039 missense possibly damaging 0.81
R7481:C3 UTSW 17 57220136 missense probably damaging 1.00
R7540:C3 UTSW 17 57206220 missense probably benign 0.01
R7746:C3 UTSW 17 57218859 missense probably damaging 1.00
R7771:C3 UTSW 17 57215797 missense probably damaging 1.00
R7884:C3 UTSW 17 57226264 missense probably benign 0.05
R8144:C3 UTSW 17 57226276 missense probably damaging 0.98
R8279:C3 UTSW 17 57215809 missense probably benign 0.28
R8284:C3 UTSW 17 57223938 missense probably benign 0.39
R8328:C3 UTSW 17 57220973 missense probably benign 0.00
R8353:C3 UTSW 17 57212643 missense probably benign 0.00
R8396:C3 UTSW 17 57221029 missense probably benign
R8429:C3 UTSW 17 57222811 missense probably damaging 1.00
R8453:C3 UTSW 17 57212643 missense probably benign 0.00
R8557:C3 UTSW 17 57224383 missense probably benign 0.00
R8738:C3 UTSW 17 57204015 makesense probably null
R8794:C3 UTSW 17 57221011 missense probably benign
R9130:C3 UTSW 17 57211678 missense probably damaging 1.00
R9296:C3 UTSW 17 57204291 missense probably benign
R9432:C3 UTSW 17 57223950 missense probably damaging 1.00
R9451:C3 UTSW 17 57224169 missense probably benign 0.03
R9542:C3 UTSW 17 57225037 missense probably damaging 1.00
R9615:C3 UTSW 17 57211669 missense probably damaging 1.00
R9624:C3 UTSW 17 57220189 missense probably benign 0.00
Z1177:C3 UTSW 17 57217144 missense probably benign 0.07
Z1177:C3 UTSW 17 57226171 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTGGTGTGAGTATCTGCC -3'
(R):5'- CATGGAGTAGGATAGGTGTTCCC -3'

Sequencing Primer
(F):5'- CTGGTGTGAGTATCTGCCAAAAC -3'
(R):5'- GATAGGTGTTCCCTCTAGAACCAG -3'
Posted On 2015-05-15