Incidental Mutation 'R4079:C3'
ID 316781
Institutional Source Beutler Lab
Gene Symbol C3
Ensembl Gene ENSMUSG00000024164
Gene Name complement component 3
Synonyms Plp, acylation stimulating protein, complement factor 3
MMRRC Submission 040976-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4079 (G1)
Quality Score 214
Status Validated
Chromosome 17
Chromosomal Location 57510970-57535136 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 57512303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1542 (D1542N)
Ref Sequence ENSEMBL: ENSMUSP00000024988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]
AlphaFold P01027
Predicted Effect possibly damaging
Transcript: ENSMUST00000024988
AA Change: D1542N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: D1542N

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:A2M_N 130 225 3.8e-17 PFAM
A2M_N_2 456 604 5.22e-38 SMART
ANATO 693 728 5.69e-15 SMART
low complexity region 752 762 N/A INTRINSIC
A2M 770 866 5.47e-32 SMART
Pfam:Thiol-ester_cl 1000 1028 4.6e-15 PFAM
Pfam:A2M_comp 1051 1284 7.3e-60 PFAM
A2M_recep 1398 1493 3.98e-43 SMART
C345C 1533 1645 1.85e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177046
Predicted Effect probably benign
Transcript: ENSMUST00000177425
SMART Domains Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

DomainStartEndE-ValueType
Pfam:A2M_N_2 1 55 1.6e-10 PFAM
PDB:3L5N|B 74 102 1e-9 PDB
Meta Mutation Damage Score 0.1622 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,247,473 (GRCm39) probably null Het
Ankfy1 C A 11: 72,580,835 (GRCm39) probably benign Het
Ap4b1 T A 3: 103,720,694 (GRCm39) N121K probably damaging Het
Arhgef12 T C 9: 42,886,588 (GRCm39) M1131V probably damaging Het
Arl5c A T 11: 97,884,327 (GRCm39) I88N probably damaging Het
Armc9 A T 1: 86,140,851 (GRCm39) probably benign Het
Bnc1 T C 7: 81,623,508 (GRCm39) E573G probably damaging Het
Btaf1 A G 19: 36,963,879 (GRCm39) T817A probably benign Het
Cadm3 A G 1: 173,169,236 (GRCm39) V293A probably benign Het
Cadps C T 14: 12,457,702 (GRCm38) A1060T probably benign Het
Cbfa2t3 A G 8: 123,374,434 (GRCm39) probably null Het
Ccdc18 C T 5: 108,306,394 (GRCm39) Q270* probably null Het
Cdc45 A T 16: 18,630,110 (GRCm39) V19D probably damaging Het
Cfap57 C A 4: 118,456,194 (GRCm39) S500I probably benign Het
Cnga3 A T 1: 37,280,946 (GRCm39) Q47L possibly damaging Het
Corin T C 5: 72,661,226 (GRCm39) D89G probably benign Het
Cox16 A T 12: 81,521,109 (GRCm39) probably benign Het
Cyp2a4 A G 7: 26,006,791 (GRCm39) N50S probably benign Het
Diaph1 T A 18: 37,986,636 (GRCm39) E1116D possibly damaging Het
Dlg5 T C 14: 24,198,328 (GRCm39) D1535G possibly damaging Het
Enpp1 A G 10: 24,544,905 (GRCm39) probably null Het
F13b T A 1: 139,429,508 (GRCm39) F9I unknown Het
Fcer1a C T 1: 173,052,920 (GRCm39) C36Y probably damaging Het
Fcho2 A G 13: 98,892,120 (GRCm39) V318A probably damaging Het
Fzd9 A G 5: 135,278,490 (GRCm39) V465A probably benign Het
Hbs1l T C 10: 21,228,501 (GRCm39) V493A probably damaging Het
Hgs T A 11: 120,373,874 (GRCm39) S723T probably benign Het
Hnrnpul1 C T 7: 25,426,300 (GRCm39) R517Q probably damaging Het
Kpna7 A G 5: 144,942,737 (GRCm39) I83T possibly damaging Het
Llgl1 C A 11: 60,601,110 (GRCm39) probably null Het
Lrig3 A C 10: 125,845,656 (GRCm39) E695A probably damaging Het
Lrpap1 A G 5: 35,253,381 (GRCm39) I261T possibly damaging Het
Mfn1 T G 3: 32,596,998 (GRCm39) L152W probably damaging Het
Mog A G 17: 37,323,302 (GRCm39) F212S probably damaging Het
Mpeg1 A G 19: 12,439,634 (GRCm39) N364S probably damaging Het
Mtmr3 C T 11: 4,441,057 (GRCm39) R531Q probably damaging Het
Mx2 A G 16: 97,357,236 (GRCm39) N443S probably damaging Het
Nfatc3 T C 8: 106,806,123 (GRCm39) Y323H probably damaging Het
Nup188 G A 2: 30,199,890 (GRCm39) D305N probably damaging Het
Obscn A G 11: 58,929,189 (GRCm39) V6145A probably benign Het
Or52x1 A T 7: 104,853,228 (GRCm39) H107Q probably damaging Het
Or8u10 A G 2: 85,915,656 (GRCm39) V155A possibly damaging Het
Patl1 C T 19: 11,908,994 (GRCm39) A467V probably damaging Het
Pdss2 A T 10: 43,278,518 (GRCm39) M342L probably benign Het
Phax A G 18: 56,709,051 (GRCm39) N183S possibly damaging Het
Pnck A T X: 72,701,761 (GRCm39) V93E probably damaging Het
Prol1 A G 5: 88,476,075 (GRCm39) N155S unknown Het
Ptprk G A 10: 28,139,508 (GRCm39) V78I probably benign Het
Ptpru A T 4: 131,526,021 (GRCm39) probably null Het
Ptprv A G 1: 135,038,168 (GRCm39) noncoding transcript Het
Ranbp3l A G 15: 9,060,838 (GRCm39) N233S probably damaging Het
Rapgefl1 A G 11: 98,740,803 (GRCm39) T552A probably benign Het
Rasgrp1 A G 2: 117,115,510 (GRCm39) S693P probably benign Het
Scyl2 A T 10: 89,476,458 (GRCm39) M889K probably benign Het
Serpina3a C T 12: 104,085,934 (GRCm39) Q320* probably null Het
Slc12a1 A T 2: 125,042,543 (GRCm39) N733I possibly damaging Het
Snap47 C T 11: 59,319,377 (GRCm39) V254I probably benign Het
Speer4e2 A T 5: 15,027,663 (GRCm39) L71Q probably damaging Het
St6galnac2 A T 11: 116,572,724 (GRCm39) L244Q possibly damaging Het
Syce1 C A 7: 140,359,809 (GRCm39) L83F probably damaging Het
Tjp2 A T 19: 24,086,182 (GRCm39) V780E possibly damaging Het
Tns1 G A 1: 74,034,467 (GRCm39) R192C probably damaging Het
Trav6-3 T C 14: 53,667,537 (GRCm39) L3P possibly damaging Het
Ung G T 5: 114,268,684 (GRCm39) probably null Het
Usp32 T A 11: 84,930,055 (GRCm39) Y574F probably damaging Het
Other mutations in C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:C3 APN 17 57,533,004 (GRCm39) missense probably benign 0.01
IGL00741:C3 APN 17 57,527,206 (GRCm39) intron probably benign
IGL01093:C3 APN 17 57,530,949 (GRCm39) missense probably damaging 1.00
IGL01309:C3 APN 17 57,516,652 (GRCm39) intron probably benign
IGL01312:C3 APN 17 57,532,993 (GRCm39) unclassified probably benign
IGL01344:C3 APN 17 57,531,880 (GRCm39) missense probably benign
IGL01514:C3 APN 17 57,522,866 (GRCm39) missense probably benign 0.04
IGL01913:C3 APN 17 57,520,767 (GRCm39) missense probably null 0.01
IGL02165:C3 APN 17 57,532,092 (GRCm39) missense probably benign 0.17
IGL02176:C3 APN 17 57,533,337 (GRCm39) unclassified probably benign
IGL02189:C3 APN 17 57,527,113 (GRCm39) missense probably benign 0.01
IGL02378:C3 APN 17 57,519,698 (GRCm39) missense probably benign 0.19
IGL02422:C3 APN 17 57,533,823 (GRCm39) missense probably damaging 0.98
IGL02715:C3 APN 17 57,511,158 (GRCm39) intron probably benign
IGL02737:C3 APN 17 57,511,281 (GRCm39) missense probably benign 0.08
IGL03201:C3 APN 17 57,529,249 (GRCm39) missense probably damaging 1.00
IGL03210:C3 APN 17 57,522,846 (GRCm39) nonsense probably null
IGL03345:C3 APN 17 57,526,585 (GRCm39) missense probably damaging 1.00
PIT4431001:C3 UTSW 17 57,513,242 (GRCm39) missense probably benign 0.00
PIT4494001:C3 UTSW 17 57,516,263 (GRCm39) missense probably benign 0.01
R0158:C3 UTSW 17 57,531,851 (GRCm39) critical splice donor site probably null
R0318:C3 UTSW 17 57,531,709 (GRCm39) missense probably damaging 0.99
R1132:C3 UTSW 17 57,514,531 (GRCm39) critical splice donor site probably null
R1765:C3 UTSW 17 57,531,401 (GRCm39) splice site probably null
R1793:C3 UTSW 17 57,526,592 (GRCm39) missense possibly damaging 0.93
R1852:C3 UTSW 17 57,529,823 (GRCm39) missense probably damaging 0.98
R1908:C3 UTSW 17 57,516,489 (GRCm39) missense probably damaging 1.00
R1919:C3 UTSW 17 57,527,135 (GRCm39) missense probably damaging 1.00
R1935:C3 UTSW 17 57,525,829 (GRCm39) missense probably damaging 1.00
R2026:C3 UTSW 17 57,525,562 (GRCm39) missense probably damaging 1.00
R2108:C3 UTSW 17 57,530,974 (GRCm39) splice site probably null
R2197:C3 UTSW 17 57,526,623 (GRCm39) missense probably benign 0.32
R2394:C3 UTSW 17 57,529,303 (GRCm39) nonsense probably null
R2998:C3 UTSW 17 57,517,284 (GRCm39) missense probably benign 0.00
R3727:C3 UTSW 17 57,514,379 (GRCm39) missense possibly damaging 0.50
R3767:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R3768:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R3769:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R3770:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R3784:C3 UTSW 17 57,533,067 (GRCm39) missense probably damaging 0.99
R3883:C3 UTSW 17 57,524,173 (GRCm39) critical splice acceptor site probably null
R3884:C3 UTSW 17 57,524,173 (GRCm39) critical splice acceptor site probably null
R3950:C3 UTSW 17 57,532,286 (GRCm39) missense probably benign 0.02
R3966:C3 UTSW 17 57,525,664 (GRCm39) missense probably damaging 0.99
R4077:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R4078:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R4168:C3 UTSW 17 57,525,608 (GRCm39) missense probably benign 0.00
R4208:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R4695:C3 UTSW 17 57,528,057 (GRCm39) missense probably benign
R4909:C3 UTSW 17 57,533,830 (GRCm39) critical splice donor site probably null
R5011:C3 UTSW 17 57,530,236 (GRCm39) missense probably benign 0.06
R5094:C3 UTSW 17 57,532,033 (GRCm39) critical splice donor site probably null
R5141:C3 UTSW 17 57,526,570 (GRCm39) missense probably damaging 0.98
R5170:C3 UTSW 17 57,530,938 (GRCm39) missense probably damaging 0.96
R5339:C3 UTSW 17 57,531,308 (GRCm39) missense probably damaging 0.99
R5369:C3 UTSW 17 57,528,159 (GRCm39) missense probably benign 0.45
R5412:C3 UTSW 17 57,527,187 (GRCm39) missense probably benign 0.01
R5439:C3 UTSW 17 57,511,502 (GRCm39) missense probably benign 0.28
R5463:C3 UTSW 17 57,518,720 (GRCm39) missense probably benign 0.08
R5546:C3 UTSW 17 57,529,976 (GRCm39) missense probably damaging 0.99
R5572:C3 UTSW 17 57,531,673 (GRCm39) missense probably damaging 0.99
R5851:C3 UTSW 17 57,518,612 (GRCm39) missense probably null 0.14
R5863:C3 UTSW 17 57,530,141 (GRCm39) missense probably benign 0.06
R5888:C3 UTSW 17 57,521,831 (GRCm39) missense probably damaging 1.00
R5940:C3 UTSW 17 57,517,244 (GRCm39) missense possibly damaging 0.64
R6073:C3 UTSW 17 57,513,223 (GRCm39) missense probably null
R6091:C3 UTSW 17 57,528,967 (GRCm39) nonsense probably null
R6286:C3 UTSW 17 57,531,118 (GRCm39) missense probably damaging 1.00
R6524:C3 UTSW 17 57,524,264 (GRCm39) critical splice donor site probably null
R6868:C3 UTSW 17 57,511,029 (GRCm39) missense possibly damaging 0.55
R6896:C3 UTSW 17 57,527,864 (GRCm39) splice site probably null
R7007:C3 UTSW 17 57,525,809 (GRCm39) missense probably benign 0.00
R7022:C3 UTSW 17 57,524,286 (GRCm39) missense probably damaging 1.00
R7099:C3 UTSW 17 57,513,276 (GRCm39) missense probably benign 0.28
R7117:C3 UTSW 17 57,519,655 (GRCm39) missense probably benign 0.01
R7347:C3 UTSW 17 57,530,215 (GRCm39) missense probably benign 0.09
R7366:C3 UTSW 17 57,528,162 (GRCm39) missense probably benign 0.00
R7423:C3 UTSW 17 57,521,767 (GRCm39) missense probably damaging 1.00
R7425:C3 UTSW 17 57,511,039 (GRCm39) missense possibly damaging 0.81
R7481:C3 UTSW 17 57,527,136 (GRCm39) missense probably damaging 1.00
R7540:C3 UTSW 17 57,513,220 (GRCm39) missense probably benign 0.01
R7746:C3 UTSW 17 57,525,859 (GRCm39) missense probably damaging 1.00
R7771:C3 UTSW 17 57,522,797 (GRCm39) missense probably damaging 1.00
R7884:C3 UTSW 17 57,533,264 (GRCm39) missense probably benign 0.05
R8144:C3 UTSW 17 57,533,276 (GRCm39) missense probably damaging 0.98
R8279:C3 UTSW 17 57,522,809 (GRCm39) missense probably benign 0.28
R8284:C3 UTSW 17 57,530,938 (GRCm39) missense probably benign 0.39
R8328:C3 UTSW 17 57,527,973 (GRCm39) missense probably benign 0.00
R8353:C3 UTSW 17 57,519,643 (GRCm39) missense probably benign 0.00
R8396:C3 UTSW 17 57,528,029 (GRCm39) missense probably benign
R8429:C3 UTSW 17 57,529,811 (GRCm39) missense probably damaging 1.00
R8453:C3 UTSW 17 57,519,643 (GRCm39) missense probably benign 0.00
R8557:C3 UTSW 17 57,531,383 (GRCm39) missense probably benign 0.00
R8738:C3 UTSW 17 57,511,015 (GRCm39) makesense probably null
R8794:C3 UTSW 17 57,528,011 (GRCm39) missense probably benign
R9130:C3 UTSW 17 57,518,678 (GRCm39) missense probably damaging 1.00
R9296:C3 UTSW 17 57,511,291 (GRCm39) missense probably benign
R9432:C3 UTSW 17 57,530,950 (GRCm39) missense probably damaging 1.00
R9451:C3 UTSW 17 57,531,169 (GRCm39) missense probably benign 0.03
R9542:C3 UTSW 17 57,532,037 (GRCm39) missense probably damaging 1.00
R9615:C3 UTSW 17 57,518,669 (GRCm39) missense probably damaging 1.00
R9624:C3 UTSW 17 57,527,189 (GRCm39) missense probably benign 0.00
Z1177:C3 UTSW 17 57,533,171 (GRCm39) missense probably damaging 0.99
Z1177:C3 UTSW 17 57,524,144 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AACTGGTGTGAGTATCTGCC -3'
(R):5'- CATGGAGTAGGATAGGTGTTCCC -3'

Sequencing Primer
(F):5'- CTGGTGTGAGTATCTGCCAAAAC -3'
(R):5'- GATAGGTGTTCCCTCTAGAACCAG -3'
Posted On 2015-05-15