Mutagenetix > Incidental Mutations

Incidental Mutation 'R4079:Mpeg1'

316785

Institutional Source

Beutler Lab

Gene Symbol

Mpeg1

Ensembl Gene

ENSMUSG00000046805

Gene Name

macrophage expressed gene 1

Synonyms

MPS1, Mpg-1

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R4079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12460779-12465284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12462270 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 364 (N364S)

Ref Sequence

ENSEMBL: ENSMUSP00000108573 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045521] [ENSMUST00000081035]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000045521

SMART Domains

Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982

Domain	Start	End	E-Value	Type
WWE	5	86	1.38e-38	SMART
WWE	88	163	6.72e-28	SMART
low complexity region	175	192	N/A	INTRINSIC
low complexity region	372	386	N/A	INTRINSIC
RING	406	464	2.2e-6	SMART
Blast:RING	510	532	3e-7	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000081035
AA Change: N364S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108573
Gene: ENSMUSG00000046805
AA Change: N364S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
MACPF	151	350	2.13e-58	SMART
transmembrane domain	661	683	N/A	INTRINSIC
low complexity region	685	698	N/A	INTRINSIC

Meta Mutation Damage Score

0.7110

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Bnc1	T	C	7: 81,973,760	E573G	probably damaging	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Mpeg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Mpeg1	APN	19	12462710	missense	probably benign	0.39
IGL00902:Mpeg1	APN	19	12461769	missense	probably damaging	1.00
IGL01141:Mpeg1	APN	19	12462785	missense	probably damaging	1.00
IGL02037:Mpeg1	APN	19	12463296	missense	probably benign	0.04
IGL02447:Mpeg1	APN	19	12462792	missense	probably damaging	1.00
IGL02448:Mpeg1	APN	19	12462609	missense	probably benign
IGL02510:Mpeg1	APN	19	12461424	missense	probably damaging	1.00
IGL03068:Mpeg1	APN	19	12462206	missense	probably benign	0.01
avoirdupois	UTSW	19	12463055	missense	probably damaging	1.00
R0128:Mpeg1	UTSW	19	12461223	missense	probably benign	0.00
R0310:Mpeg1	UTSW	19	12461691	missense	probably benign	0.00
R0312:Mpeg1	UTSW	19	12462403	missense	probably damaging	1.00
R0522:Mpeg1	UTSW	19	12461759	missense	probably damaging	0.99
R1356:Mpeg1	UTSW	19	12461325	missense	probably damaging	0.98
R1396:Mpeg1	UTSW	19	12462804	missense	probably damaging	1.00
R1436:Mpeg1	UTSW	19	12462459	missense	probably damaging	0.98
R1497:Mpeg1	UTSW	19	12461247	missense	probably benign	0.04
R1714:Mpeg1	UTSW	19	12462834	missense	probably damaging	1.00
R1846:Mpeg1	UTSW	19	12463122	missense	probably benign	0.00
R1856:Mpeg1	UTSW	19	12462356	missense	probably benign	0.04
R1933:Mpeg1	UTSW	19	12462647	nonsense	probably null
R1959:Mpeg1	UTSW	19	12462911	missense	probably damaging	1.00
R1960:Mpeg1	UTSW	19	12462911	missense	probably damaging	1.00
R1961:Mpeg1	UTSW	19	12462911	missense	probably damaging	1.00
R2240:Mpeg1	UTSW	19	12463038	missense	probably damaging	0.98
R2474:Mpeg1	UTSW	19	12462249	missense	probably damaging	1.00
R3430:Mpeg1	UTSW	19	12463128	missense	probably benign	0.22
R4245:Mpeg1	UTSW	19	12462908	missense	probably damaging	0.99
R4451:Mpeg1	UTSW	19	12463232	nonsense	probably null
R4888:Mpeg1	UTSW	19	12463070	missense	probably damaging	1.00
R4980:Mpeg1	UTSW	19	12461540	missense	probably damaging	1.00
R5071:Mpeg1	UTSW	19	12461181	start codon destroyed	probably null	0.02
R5089:Mpeg1	UTSW	19	12462997	missense	probably benign	0.00
R5120:Mpeg1	UTSW	19	12461429	nonsense	probably null
R5327:Mpeg1	UTSW	19	12461649	missense	probably damaging	1.00
R5490:Mpeg1	UTSW	19	12461693	missense	probably damaging	0.99
R5725:Mpeg1	UTSW	19	12462636	missense	probably benign	0.13
R6147:Mpeg1	UTSW	19	12462894	missense	probably damaging	1.00
R6243:Mpeg1	UTSW	19	12462240	missense	probably benign	0.26
R6486:Mpeg1	UTSW	19	12462105	missense	probably damaging	1.00
R6520:Mpeg1	UTSW	19	12461958	missense	probably benign	0.04
R7139:Mpeg1	UTSW	19	12461714	missense	probably benign	0.07
R7204:Mpeg1	UTSW	19	12462894	missense	probably damaging	1.00
R7310:Mpeg1	UTSW	19	12462251	missense	probably damaging	0.99
R7665:Mpeg1	UTSW	19	12463094	missense	probably damaging	1.00
R7674:Mpeg1	UTSW	19	12461387	missense	probably benign
R8388:Mpeg1	UTSW	19	12462914	missense	probably damaging	1.00
R8749:Mpeg1	UTSW	19	12461927	missense	probably benign	0.08
R8755:Mpeg1	UTSW	19	12461874	missense	probably damaging	0.98
R8773:Mpeg1	UTSW	19	12463055	missense	probably damaging	1.00
R8808:Mpeg1	UTSW	19	12463079	missense	probably damaging	1.00
R9037:Mpeg1	UTSW	19	12461826	missense	probably damaging	1.00
R9110:Mpeg1	UTSW	19	12462650	missense	probably benign
R9280:Mpeg1	UTSW	19	12462464	missense	probably benign	0.07
X0064:Mpeg1	UTSW	19	12461972	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGTGGCAATAGACCGTGCTG -3'
(R):5'- TTTACATTCCAGACGACTGTAACCC -3'

Sequencing Primer
(F):5'- CAATAGACCGTGCTGGCTTG -3'
(R):5'- AGACGACTGTAACCCTCTTCATGG -3'

Posted On

2015-05-15