Incidental Mutation 'R4080:Sis'
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Namesucrase isomaltase (alpha-glucosidase)
SynonymsSi-s, sucrase-isomaltase
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosomal Location72888557-72967863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72921184 bp
Amino Acid Change Tyrosine to Cysteine at position 1186 (Y1186C)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
Predicted Effect probably damaging
Transcript: ENSMUST00000094190
AA Change: Y1186C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: Y1186C

transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167334
AA Change: Y1186C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: Y1186C

transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72946636 missense probably benign
IGL00715:Sis APN 3 72934124 missense probably damaging 1.00
IGL00721:Sis APN 3 72943579 missense probably damaging 1.00
IGL00766:Sis APN 3 72907237 splice site probably benign
IGL00783:Sis APN 3 72946632 missense probably benign
IGL00805:Sis APN 3 72934199 missense probably benign 0.05
IGL00932:Sis APN 3 72940956 splice site probably benign
IGL01020:Sis APN 3 72966838 missense probably damaging 1.00
IGL01024:Sis APN 3 72911876 missense probably damaging 1.00
IGL01286:Sis APN 3 72941025 missense probably damaging 1.00
IGL01457:Sis APN 3 72961021 missense probably benign
IGL01514:Sis APN 3 72935920 splice site probably benign
IGL01986:Sis APN 3 72945212 missense probably damaging 1.00
IGL02110:Sis APN 3 72928699 nonsense probably null
IGL02132:Sis APN 3 72947471 missense probably benign 0.00
IGL02152:Sis APN 3 72888986 utr 3 prime probably benign
IGL02200:Sis APN 3 72943604 missense probably damaging 0.99
IGL02244:Sis APN 3 72956190 missense probably benign 0.19
IGL02307:Sis APN 3 72911834 splice site probably benign
IGL02374:Sis APN 3 72925456 missense probably benign 0.03
IGL02437:Sis APN 3 72919614 critical splice acceptor site probably null
IGL02571:Sis APN 3 72956304 splice site probably benign
IGL02601:Sis APN 3 72913210 missense probably benign 0.44
IGL03063:Sis APN 3 72928297 missense probably benign
IGL03382:Sis APN 3 72928719 missense probably benign 0.00
IGL03397:Sis APN 3 72935879 missense probably benign 0.44
PIT1430001:Sis UTSW 3 72922829 missense probably damaging 0.97
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0046:Sis UTSW 3 72932094 missense probably benign 0.01
R0094:Sis UTSW 3 72921437 missense probably damaging 1.00
R0096:Sis UTSW 3 72928267 missense probably damaging 1.00
R0505:Sis UTSW 3 72960296 missense probably benign 0.29
R0544:Sis UTSW 3 72951642 missense probably damaging 1.00
R0551:Sis UTSW 3 72925407 missense possibly damaging 0.79
R0617:Sis UTSW 3 72965605 missense probably damaging 1.00
R0698:Sis UTSW 3 72910498 missense probably damaging 1.00
R0701:Sis UTSW 3 72941045 missense probably damaging 1.00
R0704:Sis UTSW 3 72949822 missense possibly damaging 0.63
R0706:Sis UTSW 3 72952531 missense probably damaging 1.00
R0710:Sis UTSW 3 72952531 missense probably damaging 1.00
R0752:Sis UTSW 3 72952531 missense probably damaging 1.00
R0753:Sis UTSW 3 72952531 missense probably damaging 1.00
R0754:Sis UTSW 3 72952531 missense probably damaging 1.00
R0767:Sis UTSW 3 72952531 missense probably damaging 1.00
R0769:Sis UTSW 3 72952531 missense probably damaging 1.00
R0772:Sis UTSW 3 72952531 missense probably damaging 1.00
R0774:Sis UTSW 3 72952531 missense probably damaging 1.00
R0776:Sis UTSW 3 72952531 missense probably damaging 1.00
R0818:Sis UTSW 3 72952531 missense probably damaging 1.00
R0819:Sis UTSW 3 72952531 missense probably damaging 1.00
R0885:Sis UTSW 3 72911949 nonsense probably null
R1076:Sis UTSW 3 72934098 missense probably damaging 0.97
R1140:Sis UTSW 3 72951616 missense probably damaging 0.98
R1175:Sis UTSW 3 72958104 splice site probably benign
R1301:Sis UTSW 3 72946582 missense possibly damaging 0.76
R1437:Sis UTSW 3 72934142 missense probably damaging 1.00
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1472:Sis UTSW 3 72889027 missense probably benign 0.12
R1584:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1707:Sis UTSW 3 72909087 splice site probably benign
R1715:Sis UTSW 3 72889010 missense possibly damaging 0.47
R1719:Sis UTSW 3 72965604 missense probably damaging 1.00
R1728:Sis UTSW 3 72965645 nonsense probably null
R1784:Sis UTSW 3 72965645 nonsense probably null
R1820:Sis UTSW 3 72921142 missense probably damaging 1.00
R1972:Sis UTSW 3 72921004 missense probably damaging 1.00
R1973:Sis UTSW 3 72921004 missense probably damaging 1.00
R2054:Sis UTSW 3 72913237 missense probably benign 0.01
R2233:Sis UTSW 3 72913194 missense probably benign 0.03
R2235:Sis UTSW 3 72913194 missense probably benign 0.03
R2276:Sis UTSW 3 72914601 nonsense probably null
R2435:Sis UTSW 3 72911904 missense probably benign 0.01
R2885:Sis UTSW 3 72909173 missense probably benign 0.01
R2966:Sis UTSW 3 72889010 missense probably benign 0.30
R3708:Sis UTSW 3 72943523 missense probably benign 0.02
R3790:Sis UTSW 3 72921414 missense probably damaging 1.00
R3807:Sis UTSW 3 72925596 missense probably benign 0.01
R3858:Sis UTSW 3 72928652 missense probably damaging 0.99
R3974:Sis UTSW 3 72943635 missense probably damaging 0.96
R3975:Sis UTSW 3 72943635 missense probably damaging 0.96
R4037:Sis UTSW 3 72928602 missense probably benign
R4204:Sis UTSW 3 72961082 missense probably benign
R4394:Sis UTSW 3 72956149 missense probably damaging 1.00
R4470:Sis UTSW 3 72928159 splice site probably null
R4573:Sis UTSW 3 72928237 missense possibly damaging 0.94
R4868:Sis UTSW 3 72943548 missense probably benign 0.09
R5023:Sis UTSW 3 72934122 missense probably benign 0.05
R5264:Sis UTSW 3 72949756 missense probably damaging 0.98
R5414:Sis UTSW 3 72952493 missense probably benign
R5462:Sis UTSW 3 72949838 missense probably damaging 0.96
R5523:Sis UTSW 3 72891421 missense probably benign 0.00
R5584:Sis UTSW 3 72910415 missense probably damaging 1.00
R5587:Sis UTSW 3 72914576 missense possibly damaging 0.94
R5725:Sis UTSW 3 72965598 missense probably damaging 1.00
R5769:Sis UTSW 3 72928235 missense probably damaging 0.98
R5790:Sis UTSW 3 72928174 missense probably benign
R5864:Sis UTSW 3 72949818 missense probably damaging 1.00
R5902:Sis UTSW 3 72960256 critical splice donor site probably null
R5925:Sis UTSW 3 72921380 splice site probably null
R6018:Sis UTSW 3 72913192 missense possibly damaging 0.95
R6029:Sis UTSW 3 72928308 missense probably benign 0.30
R6124:Sis UTSW 3 72953211 missense possibly damaging 0.69
R6171:Sis UTSW 3 72961027 missense possibly damaging 0.75
R6182:Sis UTSW 3 72904293 missense probably benign 0.05
R6295:Sis UTSW 3 72966770 missense probably damaging 0.99
R6416:Sis UTSW 3 72911854 missense probably damaging 1.00
R6431:Sis UTSW 3 72958174 missense probably benign 0.00
R6472:Sis UTSW 3 72938734 nonsense probably null
R6517:Sis UTSW 3 72907142 missense probably damaging 1.00
R6701:Sis UTSW 3 72949527 missense probably damaging 1.00
R6796:Sis UTSW 3 72965618 missense probably benign 0.06
R6853:Sis UTSW 3 72891426 missense possibly damaging 0.93
R6906:Sis UTSW 3 72919485 missense probably damaging 1.00
R7058:Sis UTSW 3 72903607 missense probably damaging 0.98
R7357:Sis UTSW 3 72925071 missense probably damaging 1.00
R7381:Sis UTSW 3 72913292 splice site probably null
R7439:Sis UTSW 3 72909041 missense possibly damaging 0.81
R7742:Sis UTSW 3 72925098 missense probably benign 0.19
R7813:Sis UTSW 3 72925468 missense probably benign 0.01
R7883:Sis UTSW 3 72920996 missense possibly damaging 0.78
R7899:Sis UTSW 3 72937251 missense probably damaging 1.00
R7915:Sis UTSW 3 72921138 missense probably damaging 0.99
R7985:Sis UTSW 3 72936961 splice site probably null
R8020:Sis UTSW 3 72908965 critical splice donor site probably null
R8023:Sis UTSW 3 72952480 missense probably damaging 0.97
R8029:Sis UTSW 3 72921142 missense probably damaging 1.00
R8053:Sis UTSW 3 72949568 nonsense probably null
R8062:Sis UTSW 3 72920988 nonsense probably null
R8074:Sis UTSW 3 72917198 missense probably damaging 1.00
R8085:Sis UTSW 3 72907129 missense probably damaging 1.00
R8137:Sis UTSW 3 72889045 missense probably benign 0.22
R8349:Sis UTSW 3 72903651 missense probably damaging 1.00
R8354:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8366:Sis UTSW 3 72958233 missense probably damaging 1.00
R8449:Sis UTSW 3 72903651 missense probably damaging 1.00
R8454:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8474:Sis UTSW 3 72929397 missense probably damaging 1.00
R8515:Sis UTSW 3 72929409 missense probably benign 0.00
R8680:Sis UTSW 3 72960295 missense probably damaging 1.00
R8703:Sis UTSW 3 72960324 missense probably damaging 1.00
X0009:Sis UTSW 3 72889022 missense probably damaging 0.99
X0024:Sis UTSW 3 72928670 missense probably benign
X0060:Sis UTSW 3 72920906 intron probably benign
Z1176:Sis UTSW 3 72904273 missense probably benign 0.05
Z1176:Sis UTSW 3 72943557 missense probably benign 0.25
Z1177:Sis UTSW 3 72909172 missense possibly damaging 0.88
Z1177:Sis UTSW 3 72910474 missense probably damaging 1.00
Z1177:Sis UTSW 3 72943569 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-15