Incidental Mutation 'R4080:Lrrc41'
ID316801
Institutional Source Beutler Lab
Gene Symbol Lrrc41
Ensembl Gene ENSMUSG00000028703
Gene Nameleucine rich repeat containing 41
SynonymsD730026A16Rik, MUF1, D630045E04Rik
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116075269-116097043 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 116080546 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030471]
Predicted Effect probably null
Transcript: ENSMUST00000030471
SMART Domains Protein: ENSMUSP00000030471
Gene: ENSMUSG00000028703

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 352 382 N/A INTRINSIC
low complexity region 417 429 N/A INTRINSIC
SCOP:d1yrga_ 449 742 4e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154274
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Lrrc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Lrrc41 APN 4 116096466 missense probably damaging 0.97
IGL01358:Lrrc41 APN 4 116075587 missense probably benign 0.16
IGL01734:Lrrc41 APN 4 116093134 critical splice donor site probably null
IGL01986:Lrrc41 APN 4 116089322 missense probably benign 0.27
IGL02159:Lrrc41 APN 4 116088486 missense probably benign 0.03
IGL02892:Lrrc41 APN 4 116088835 missense possibly damaging 0.68
IGL03135:Lrrc41 APN 4 116088531 missense probably benign
R1478:Lrrc41 UTSW 4 116095208 nonsense probably null
R1765:Lrrc41 UTSW 4 116089051 missense possibly damaging 0.94
R2233:Lrrc41 UTSW 4 116096385 missense possibly damaging 0.66
R4677:Lrrc41 UTSW 4 116095135 missense probably benign
R4833:Lrrc41 UTSW 4 116093177 unclassified probably benign
R4877:Lrrc41 UTSW 4 116079405 missense probably damaging 0.99
R4926:Lrrc41 UTSW 4 116089324 missense possibly damaging 0.46
R6459:Lrrc41 UTSW 4 116088780 missense possibly damaging 0.95
R6817:Lrrc41 UTSW 4 116089305 missense possibly damaging 0.66
R6834:Lrrc41 UTSW 4 116096529 missense possibly damaging 0.46
R7479:Lrrc41 UTSW 4 116089041 missense probably damaging 0.96
R7512:Lrrc41 UTSW 4 116092994 missense possibly damaging 0.66
R7593:Lrrc41 UTSW 4 116092944 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTAGCTTTCCCATGATCATATAGC -3'
(R):5'- GCCAAATGAGCCAAAACTGTGTG -3'

Sequencing Primer
(F):5'- GCTTTCCCATGATCATATAGCTTTAG -3'
(R):5'- TGAGCCAAAACTGTGTGACAAATC -3'
Posted On2015-05-15