Mutagenetix > Incidental Mutations

Incidental Mutation 'R4080:Adgrf3'

316804

Institutional Source

Beutler Lab

Gene Symbol

Adgrf3

Ensembl Gene

ENSMUSG00000067642

Gene Name

adhesion G protein-coupled receptor F3

Synonyms

Gpr113, LOC381628, PGR23

MMRRC Submission

040856-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4080 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30193431-30205722 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 30197369 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 554 (Q554*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]

Predicted Effect

probably null
Transcript: ENSMUST00000088117
AA Change: Q554*

SMART Domains

Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: Q554*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
Blast:IG	163	252	2e-20	BLAST
Blast:CCP	341	399	1e-6	BLAST
low complexity region	403	415	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
GPS	632	684	2.68e-17	SMART
Pfam:7tm_2	687	935	1e-30	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000114774
AA Change: Q554*

SMART Domains

Protein: ENSMUSP00000110422
Gene: ENSMUSG00000067642
AA Change: Q554*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
Blast:IG	163	252	2e-20	BLAST
Blast:CCP	341	399	1e-6	BLAST
Pfam:DUF3497	417	609	1.1e-12	PFAM
GPS	631	683	2.68e-17	SMART
Pfam:7tm_2	686	934	5.3e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125367

SMART Domains

Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135322

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	G	T	12: 55,304,613	V236F	possibly damaging	Het
Aass	A	T	6: 23,109,498	D324E	possibly damaging	Het
Adam7	T	C	14: 68,520,539	T245A	probably benign	Het
Aim2	T	C	1: 173,459,851		probably null	Het
Arhgef1	G	T	7: 24,925,846	D850Y	probably damaging	Het
Aspm	C	A	1: 139,470,755	Q1024K	probably damaging	Het
C7	T	C	15: 4,990,464	S734G	probably benign	Het
Ccdc158	A	T	5: 92,623,396	S987T	probably benign	Het
Chrna2	G	T	14: 66,143,417	G45V	probably benign	Het
Chrna2	C	A	14: 66,143,424	Y47*	probably null	Het
Clec2g	C	A	6: 128,981,324	Q117K	probably damaging	Het
Cntnap5a	A	G	1: 116,101,574	S253G	probably benign	Het
Cttn	T	A	7: 144,457,724	D116V	probably damaging	Het
Cyp2c40	A	G	19: 39,802,529	V286A	probably benign	Het
Dcbld2	T	A	16: 58,465,373	S632T	probably damaging	Het
Dscam	A	T	16: 96,683,772	N1118K	probably benign	Het
Eif2a	C	T	3: 58,539,629	T92M	possibly damaging	Het
Frmpd1	T	A	4: 45,284,382	C1068S	probably benign	Het
Fstl1	G	A	16: 37,822,603	V110I	probably benign	Het
Gpat2	T	C	2: 127,433,622	I465T	probably damaging	Het
Gpr137	C	T	19: 6,940,423		probably benign	Het
Hgsnat	A	G	8: 25,946,343	I561T	probably benign	Het
Ift74	T	A	4: 94,652,912		probably null	Het
Ilf3	A	G	9: 21,403,134		probably null	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrrc41	C	A	4: 116,080,546		probably null	Het
Myh11	C	A	16: 14,224,059	R700L	possibly damaging	Het
Myo16	A	G	8: 10,562,240	D1295G	probably damaging	Het
Myo5b	A	G	18: 74,740,488	M1488V	probably benign	Het
Naip6	A	T	13: 100,299,307	Y903N	probably damaging	Het
Nek6	A	G	2: 38,550,637	H19R	probably damaging	Het
Nktr	A	C	9: 121,741,126	T127P	probably damaging	Het
Noc4l	A	T	5: 110,649,872	D335E	probably benign	Het
Nsd1	A	G	13: 55,301,809	D1993G	probably damaging	Het
Olfr1377	G	A	11: 50,984,856	D52N	probably damaging	Het
Olfr190	A	T	16: 59,074,256	F275I	probably damaging	Het
Pabpc2	A	T	18: 39,775,530	Q616L	possibly damaging	Het
Pcdhga4	A	T	18: 37,685,779	D127V	probably damaging	Het
Phrf1	T	C	7: 141,259,720		probably benign	Het
Phtf2	T	A	5: 20,813,296	I16F	probably damaging	Het
Plekhg3	G	T	12: 76,577,981	R1200L	probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Prss12	A	G	3: 123,485,485	N404D	probably benign	Het
Ptch2	C	G	4: 117,111,206	A926G	probably damaging	Het
Ptpa	T	C	2: 30,443,305	F6L	probably damaging	Het
Reck	T	C	4: 43,942,293	I853T	possibly damaging	Het
Reep6	G	A	10: 80,330,162		probably benign	Het
Rex2	T	A	4: 147,058,697	S547R	probably benign	Het
Rgs22	C	T	15: 36,107,076	E55K	probably damaging	Het
Rtl6	T	C	15: 84,557,001	T65A	possibly damaging	Het
Scarb1	G	T	5: 125,277,795	P491Q	probably damaging	Het
Scfd1	A	G	12: 51,431,519	S505G	probably benign	Het
Scube1	T	G	15: 83,608,747	Q904P	probably damaging	Het
Sis	T	C	3: 72,921,184	Y1186C	probably damaging	Het
Spta1	A	G	1: 174,214,066	D1334G	probably benign	Het
Spty2d1	T	C	7: 46,998,581	E200G	probably damaging	Het
Stard13	C	A	5: 151,092,829		probably null	Het
Sybu	T	C	15: 44,718,943	K95R	probably damaging	Het
Trappc9	T	A	15: 72,941,947	D488V	probably damaging	Het
Txk	G	A	5: 72,700,663	P381S	probably damaging	Het
Ubr2	A	T	17: 46,988,722	M198K	probably benign	Het
Unc5a	A	T	13: 55,004,481	T786S	possibly damaging	Het
Unc93b1	G	A	19: 3,941,959	R231Q	probably damaging	Het
Wfdc1	T	A	8: 119,683,793		probably null	Het
Zfp667	T	G	7: 6,305,106	C258G	possibly damaging	Het
Zfr	G	A	15: 12,162,233	R823H	probably benign	Het

Other mutations in Adgrf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03080:Adgrf3	APN	5	30196829	missense	probably benign	0.02
IGL03171:Adgrf3	APN	5	30196294	missense	probably damaging	1.00
R0010:Adgrf3	UTSW	5	30205609	splice site	probably benign
R0042:Adgrf3	UTSW	5	30197428	missense	probably damaging	1.00
R0140:Adgrf3	UTSW	5	30196381	missense	probably benign	0.19
R0617:Adgrf3	UTSW	5	30195080	missense	probably benign	0.25
R0748:Adgrf3	UTSW	5	30196876	missense	probably damaging	1.00
R1291:Adgrf3	UTSW	5	30199534	missense	probably damaging	0.99
R1330:Adgrf3	UTSW	5	30195095	missense	probably benign	0.24
R1468:Adgrf3	UTSW	5	30202229	splice site	probably benign
R1695:Adgrf3	UTSW	5	30203555	missense	probably benign	0.05
R1716:Adgrf3	UTSW	5	30197551	missense	probably benign	0.03
R1844:Adgrf3	UTSW	5	30199213	missense	probably damaging	0.96
R1935:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R1936:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R2059:Adgrf3	UTSW	5	30199491	missense	possibly damaging	0.91
R2656:Adgrf3	UTSW	5	30196438	missense	possibly damaging	0.96
R2913:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2914:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2987:Adgrf3	UTSW	5	30197360	missense	probably damaging	1.00
R3797:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3798:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3799:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3934:Adgrf3	UTSW	5	30200434	unclassified	probably benign
R4043:Adgrf3	UTSW	5	30204362	missense	probably benign	0.00
R4575:Adgrf3	UTSW	5	30202257	missense	probably benign	0.00
R4754:Adgrf3	UTSW	5	30197617	critical splice acceptor site	probably null
R4819:Adgrf3	UTSW	5	30198444	missense	possibly damaging	0.66
R4893:Adgrf3	UTSW	5	30200478	missense	probably benign	0.00
R4991:Adgrf3	UTSW	5	30199148	missense	probably benign	0.26
R5686:Adgrf3	UTSW	5	30197306	missense	probably damaging	1.00
R5965:Adgrf3	UTSW	5	30205639	missense	probably benign	0.00
R5997:Adgrf3	UTSW	5	30198362	critical splice donor site	probably null
R6103:Adgrf3	UTSW	5	30196267	missense	probably damaging	1.00
R6244:Adgrf3	UTSW	5	30197533	missense	probably benign	0.17
R6409:Adgrf3	UTSW	5	30197314	missense	probably damaging	0.96
R6575:Adgrf3	UTSW	5	30196524	missense	possibly damaging	0.72
R6745:Adgrf3	UTSW	5	30203603	missense	probably benign	0.31
R6790:Adgrf3	UTSW	5	30196387	missense	probably benign	0.00
R6813:Adgrf3	UTSW	5	30197521	missense	probably damaging	0.96
R7202:Adgrf3	UTSW	5	30204380	nonsense	probably null
R7250:Adgrf3	UTSW	5	30195682	missense	probably damaging	1.00
R7353:Adgrf3	UTSW	5	30198497	missense	probably damaging	0.98
R7634:Adgrf3	UTSW	5	30202247	missense	probably benign	0.01
R7658:Adgrf3	UTSW	5	30197206	missense	probably benign	0.41
R8037:Adgrf3	UTSW	5	30199512	missense	probably damaging	1.00
R8281:Adgrf3	UTSW	5	30197303	missense	possibly damaging	0.46
Z1088:Adgrf3	UTSW	5	30199120	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GTCTGCTGTTATGGAGACCAC -3'
(R):5'- TTCTAGACGCGAACATCAGC -3'

Sequencing Primer
(F):5'- TGCTGTTATGGAGACCACAAGGATC -3'
(R):5'- AACATCAGCGCTCTGTGGACTC -3'

Posted On

2015-05-15