Incidental Mutation 'R4080:Ccdc158'
ID316806
Institutional Source Beutler Lab
Gene Symbol Ccdc158
Ensembl Gene ENSMUSG00000050050
Gene Namecoiled-coil domain containing 158
Synonyms4932413O14Rik
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location92607954-92675271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92623396 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 987 (S987T)
Ref Sequence ENSEMBL: ENSMUSP00000063050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060930]
Predicted Effect probably benign
Transcript: ENSMUST00000060930
AA Change: S987T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063050
Gene: ENSMUSG00000050050
AA Change: S987T

DomainStartEndE-ValueType
Pfam:CCDC158 1 1109 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Ccdc158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ccdc158 APN 5 92657881 missense probably benign 0.01
IGL00926:Ccdc158 APN 5 92650767 missense probably damaging 0.98
IGL01533:Ccdc158 APN 5 92609956 splice site probably null
IGL01551:Ccdc158 APN 5 92666761 missense probably damaging 0.96
IGL01591:Ccdc158 APN 5 92662041 missense probably benign 0.28
IGL01722:Ccdc158 APN 5 92662739 missense possibly damaging 0.93
IGL02250:Ccdc158 APN 5 92608478 missense probably damaging 1.00
IGL02457:Ccdc158 APN 5 92650048 missense probably damaging 1.00
IGL02570:Ccdc158 APN 5 92649026 missense possibly damaging 0.81
IGL02951:Ccdc158 APN 5 92650006 missense probably damaging 1.00
IGL03275:Ccdc158 APN 5 92629632 missense probably benign 0.00
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0747:Ccdc158 UTSW 5 92633297 missense probably benign 0.00
R1219:Ccdc158 UTSW 5 92654181 splice site probably benign
R1480:Ccdc158 UTSW 5 92649044 missense probably damaging 1.00
R1926:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R2172:Ccdc158 UTSW 5 92632508 missense probably damaging 1.00
R2245:Ccdc158 UTSW 5 92609952 unclassified probably benign
R3004:Ccdc158 UTSW 5 92649070 missense probably damaging 1.00
R3147:Ccdc158 UTSW 5 92657963 missense probably damaging 1.00
R3693:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3694:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3735:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3736:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3912:Ccdc158 UTSW 5 92648935 missense possibly damaging 0.90
R4026:Ccdc158 UTSW 5 92643807 missense probably benign 0.07
R4463:Ccdc158 UTSW 5 92634300 missense probably null 0.99
R4483:Ccdc158 UTSW 5 92633328 missense probably benign 0.01
R4859:Ccdc158 UTSW 5 92633403 missense probably damaging 0.99
R5016:Ccdc158 UTSW 5 92657892 missense probably benign 0.01
R5050:Ccdc158 UTSW 5 92666879 missense probably benign 0.01
R5372:Ccdc158 UTSW 5 92632560 missense possibly damaging 0.55
R5427:Ccdc158 UTSW 5 92648962 missense probably damaging 1.00
R5847:Ccdc158 UTSW 5 92627480 missense probably benign 0.00
R5966:Ccdc158 UTSW 5 92650049 missense probably damaging 1.00
R6106:Ccdc158 UTSW 5 92627466 missense probably benign
R6185:Ccdc158 UTSW 5 92666854 missense possibly damaging 0.73
R6562:Ccdc158 UTSW 5 92662722 missense probably damaging 0.99
R6743:Ccdc158 UTSW 5 92662146 missense probably benign 0.08
R6815:Ccdc158 UTSW 5 92612486 missense probably damaging 0.99
R6914:Ccdc158 UTSW 5 92662070 missense probably benign 0.00
R6975:Ccdc158 UTSW 5 92666720 nonsense probably null
R7252:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R7477:Ccdc158 UTSW 5 92650696 missense probably damaging 0.96
R7782:Ccdc158 UTSW 5 92645514 missense probably benign 0.00
R8014:Ccdc158 UTSW 5 92649030 missense probably damaging 1.00
R8018:Ccdc158 UTSW 5 92623401 missense possibly damaging 0.64
R8028:Ccdc158 UTSW 5 92634251 missense probably damaging 1.00
X0025:Ccdc158 UTSW 5 92662012 missense probably benign
Z1176:Ccdc158 UTSW 5 92608491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAATCTGAGGTGGTTGGC -3'
(R):5'- TACTCCCATGACTAGGCTCC -3'

Sequencing Primer
(F):5'- CAATGTTGGCACTGTAGGTGG -3'
(R):5'- GAGAGCCTCCACAGTCCAGTC -3'
Posted On2015-05-15