Mutagenetix > Incidental Mutation

Incidental Mutation 'R0391:Itpr1'

31681

Institutional Source

Beutler Lab

Gene Symbol

Itpr1

Ensembl Gene

ENSMUSG00000030102

Gene Name

inositol 1,4,5-trisphosphate receptor 1

Synonyms

P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt

MMRRC Submission

038597-MU

Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Essential gene?

Probably essential (E-score: 0.839) question?

Stock #

R0391 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108213096-108551109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108378167 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 473 (V473A)

Ref Sequence

ENSEMBL: ENSMUSP00000144880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000203936]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000032192
AA Change: V473A

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: V473A

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1758	1787	N/A	INTRINSIC
Pfam:RIH_assoc	1959	2069	1.2e-33	PFAM
transmembrane domain	2274	2296	N/A	INTRINSIC
Pfam:Ion_trans	2311	2600	9e-22	PFAM
coiled coil region	2683	2732	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000203615
AA Change: V473A

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: V473A

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1757	1786	N/A	INTRINSIC
Pfam:RIH_assoc	1958	2068	1.2e-33	PFAM
transmembrane domain	2273	2295	N/A	INTRINSIC
Pfam:Ion_trans	2310	2599	9e-22	PFAM
coiled coil region	2682	2731	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000203936

SMART Domains

Protein: ENSMUSP00000145526
Gene: ENSMUSG00000030102

Domain	Start	End	E-Value	Type
MIR	5	61	1.3e-11	SMART
MIR	68	162	1.6e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203995

Meta Mutation Damage Score

0.1312

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.8%

Validation Efficiency

97% (97/100)

MGI Phenotype

Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]

Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	T	A	4: 122,701,177		probably benign	Het
Abcc2	G	A	19: 43,821,605		probably benign	Het
Abcc8	C	G	7: 46,122,173	G838A	probably damaging	Het
Akr1c21	G	A	13: 4,581,200	A245T	probably damaging	Het
Anapc15-ps	T	C	10: 95,673,277	E47G	probably damaging	Het
Apoa1	A	G	9: 46,229,842	T79A	probably benign	Het
Atp6v1b1	A	G	6: 83,756,921	H378R	possibly damaging	Het
C4b	A	G	17: 34,735,614		probably benign	Het
Catsperd	A	T	17: 56,662,821	E638D	probably benign	Het
Cckar	C	T	5: 53,706,253		probably null	Het
Cfap100	C	T	6: 90,405,339		probably benign	Het
Chd1	G	T	17: 15,749,894	G970C	probably damaging	Het
Col14a1	A	G	15: 55,446,259		probably benign	Het
Col17a1	C	T	19: 47,663,824	V698M	probably damaging	Het
Cpeb1	T	C	7: 81,361,725	D156G	possibly damaging	Het
Cryl1	A	G	14: 57,303,775	Y151H	possibly damaging	Het
Csmd3	C	A	15: 47,657,573	V1881L	probably damaging	Het
Ctnnal1	C	T	4: 56,847,921	A73T	probably damaging	Het
Cyp2c37	T	C	19: 39,994,506	S180P	probably damaging	Het
Cyp2c54	T	C	19: 40,072,169	T123A	possibly damaging	Het
Dennd6b	T	C	15: 89,187,214	D304G	probably damaging	Het
Dnmt3l	T	C	10: 78,051,916		probably benign	Het
Eci1	G	A	17: 24,433,260		probably null	Het
Efhc1	A	G	1: 20,960,188	Y115C	probably damaging	Het
Ern1	T	A	11: 106,407,178	K706*	probably null	Het
Fam129c	T	A	8: 71,602,499		probably benign	Het
Ghrl	T	C	6: 113,719,338	E31G	probably damaging	Het
Gpr108	A	C	17: 57,243,101	V179G	probably benign	Het
Henmt1	A	G	3: 108,958,535		probably benign	Het
Ift172	A	G	5: 31,286,667	V69A	probably damaging	Het
Il17ra	T	C	6: 120,476,979		probably benign	Het
Il17rb	T	C	14: 30,004,347	N95D	probably benign	Het
Il17rb	G	T	14: 30,006,155		probably null	Het
Iqub	G	A	6: 24,446,155	L757F	probably benign	Het
Itpr2	T	G	6: 146,229,773	N1978H	probably damaging	Het
Klk1b26	T	A	7: 44,012,727	F3Y	probably damaging	Het
Lars	A	G	18: 42,251,363	V50A	probably benign	Het
Lax1	G	T	1: 133,680,066	H312Q	probably benign	Het
Lctl	T	C	9: 64,122,314		probably benign	Het
Lrp2	T	A	2: 69,456,858	D3745V	probably damaging	Het
Lrp2	G	A	2: 69,460,337		probably benign	Het
Lvrn	A	T	18: 46,850,466	H92L	probably benign	Het
March1	A	G	8: 66,418,973	T385A	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mbd5	T	C	2: 49,272,416	V970A	possibly damaging	Het
Mccc1	A	G	3: 35,963,570		probably benign	Het
Mpp4	A	T	1: 59,143,829		probably benign	Het
Mrnip	G	A	11: 50,199,920	A304T	probably damaging	Het
Muc5b	T	C	7: 141,865,082	S3922P	possibly damaging	Het
Myh3	T	A	11: 67,096,507		probably benign	Het
Nbea	A	T	3: 56,037,277	H555Q	probably damaging	Het
Nlrp9c	A	T	7: 26,371,476		probably benign	Het
Nmur1	A	T	1: 86,387,678	V178E	probably damaging	Het
Nod2	T	G	8: 88,663,778	S238A	probably benign	Het
Ogfod1	A	T	8: 94,063,023	T451S	probably damaging	Het
Olfr145	G	A	9: 37,897,842	G146D	probably benign	Het
Olfr23	T	C	11: 73,941,109	F288L	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr716	T	A	7: 107,148,187	Y290*	probably null	Het
Pcdh20	T	C	14: 88,468,668	I399V	probably benign	Het
Pdlim1	G	T	19: 40,243,573	H120Q	probably damaging	Het
Plg	T	C	17: 12,419,081	V798A	probably damaging	Het
Polr2c	A	G	8: 94,857,775	I39V	possibly damaging	Het
Ppfia2	C	A	10: 106,830,714		probably benign	Het
Ppp1r3a	A	T	6: 14,719,697	I406N	probably benign	Het
Psg28	A	T	7: 18,426,173	M366K	probably benign	Het
Rad54b	T	C	4: 11,601,702	I419T	probably damaging	Het
Rnf43	A	G	11: 87,731,282	Q403R	possibly damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Slc28a3	A	G	13: 58,569,415		probably benign	Het
Smad2	A	T	18: 76,289,037		probably null	Het
Smad4	G	A	18: 73,658,649	P274S	probably benign	Het
Smchd1	A	T	17: 71,403,154	V906D	probably damaging	Het
Soat2	C	A	15: 102,158,753	R320S	possibly damaging	Het
Spata33	C	T	8: 123,221,887	A57V	probably damaging	Het
Stab1	A	G	14: 31,143,418	L1814P	probably benign	Het
Stab2	T	C	10: 86,947,144	K680R	probably benign	Het
Stil	A	G	4: 115,041,172		probably null	Het
Sympk	T	A	7: 19,046,849	L759H	probably benign	Het
Tet1	A	T	10: 62,814,546		probably null	Het
Tfpi2	A	T	6: 3,965,460	N117K	probably benign	Het
Tle3	A	G	9: 61,416,661	Y766C	probably damaging	Het
Trpt1	C	A	19: 6,997,930		probably null	Het
Tshz1	A	G	18: 84,016,049	F78S	possibly damaging	Het
Ttc1	T	C	11: 43,738,808	D177G	probably damaging	Het
Ttc13	T	A	8: 124,674,401	Y741F	probably damaging	Het
Ulk3	C	T	9: 57,594,832	S462L	probably benign	Het
Utrn	C	T	10: 12,525,333		probably benign	Het
V1rd19	A	C	7: 24,003,585	T159P	probably damaging	Het
Vars	T	C	17: 35,011,486	V515A	possibly damaging	Het
Vmn1r85	A	G	7: 13,084,588	Y210H	probably benign	Het
Vmn2r89	A	G	14: 51,455,978	T262A	probably damaging	Het
Vps53	G	A	11: 76,121,579	T209I	probably benign	Het
Wdfy2	T	C	14: 62,925,133	F95L	possibly damaging	Het
Wwp1	G	T	4: 19,627,911	S694Y	probably damaging	Het
Zbtb8b	T	A	4: 129,432,670	D201V	probably damaging	Het
Zmym5	A	C	14: 56,804,451	N123K	possibly damaging	Het

Other mutations in Itpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Itpr1	APN	6	108471120	missense	probably damaging	0.98
IGL01073:Itpr1	APN	6	108413820	missense	probably benign	0.00
IGL01105:Itpr1	APN	6	108381333	missense	probably benign	0.00
IGL01296:Itpr1	APN	6	108399361	missense	probably damaging	1.00
IGL01325:Itpr1	APN	6	108381208	missense	probably benign	0.01
IGL01418:Itpr1	APN	6	108339624	critical splice donor site	probably null
IGL01464:Itpr1	APN	6	108386727	missense	possibly damaging	0.95
IGL01467:Itpr1	APN	6	108488496	missense	probably damaging	0.96
IGL01645:Itpr1	APN	6	108473599	missense	possibly damaging	0.91
IGL01672:Itpr1	APN	6	108381032	nonsense	probably null
IGL01969:Itpr1	APN	6	108377691	missense	probably damaging	1.00
IGL02164:Itpr1	APN	6	108389483	missense	probably benign	0.08
IGL02206:Itpr1	APN	6	108549820	missense	probably damaging	1.00
IGL02232:Itpr1	APN	6	108417923	missense	probably damaging	1.00
IGL02297:Itpr1	APN	6	108339517	missense	possibly damaging	0.84
IGL02434:Itpr1	APN	6	108489922	splice site	probably null
IGL02568:Itpr1	APN	6	108339554	missense	possibly damaging	0.82
IGL02992:Itpr1	APN	6	108381315	missense	probably damaging	1.00
IGL03109:Itpr1	APN	6	108417981	missense	probably damaging	1.00
IGL03130:Itpr1	APN	6	108523401	missense	probably benign	0.00
IGL03333:Itpr1	APN	6	108380910	unclassified	probably benign
aboriginal	UTSW	6	108515947	missense	probably benign
approximation	UTSW	6	108394841	missense	probably benign
estimate	UTSW	6	108389553	missense	probably null	1.00
icarus	UTSW	6	108410900	missense	probably damaging	1.00
marsupialized	UTSW	6	108394073	splice site	probably null
primordial	UTSW	6	108518755	missense	probably benign	0.06
roo	UTSW	6	108410867	missense	probably benign	0.00
wallaby	UTSW	6	108389387	missense	probably damaging	1.00
P0005:Itpr1	UTSW	6	108381257	missense	probably damaging	1.00
PIT4366001:Itpr1	UTSW	6	108493757	nonsense	probably null
R0019:Itpr1	UTSW	6	108354626	missense	probably damaging	1.00
R0128:Itpr1	UTSW	6	108471209	splice site	probably benign
R0129:Itpr1	UTSW	6	108349676	missense	probably damaging	1.00
R0135:Itpr1	UTSW	6	108488482	splice site	probably benign
R0244:Itpr1	UTSW	6	108473589	missense	probably benign	0.00
R0543:Itpr1	UTSW	6	108515748	splice site	probably benign
R0647:Itpr1	UTSW	6	108383698	missense	probably damaging	1.00
R0766:Itpr1	UTSW	6	108410900	missense	probably damaging	1.00
R0971:Itpr1	UTSW	6	108349629	missense	possibly damaging	0.70
R1083:Itpr1	UTSW	6	108510696	missense	possibly damaging	0.92
R1277:Itpr1	UTSW	6	108339621	missense	probably benign	0.22
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1605:Itpr1	UTSW	6	108349659	missense	possibly damaging	0.77
R1661:Itpr1	UTSW	6	108482897	missense	probably benign	0.38
R1852:Itpr1	UTSW	6	108386706	missense	probably damaging	1.00
R1929:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2012:Itpr1	UTSW	6	108440536	missense	probably benign	0.02
R2027:Itpr1	UTSW	6	108386853	missense	possibly damaging	0.80
R2111:Itpr1	UTSW	6	108378309	unclassified	probably benign
R2166:Itpr1	UTSW	6	108388225	missense	probably damaging	1.00
R2272:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2484:Itpr1	UTSW	6	108369110	missense	probably damaging	1.00
R3115:Itpr1	UTSW	6	108406109	missense	possibly damaging	0.55
R3751:Itpr1	UTSW	6	108349680	missense	probably damaging	1.00
R3798:Itpr1	UTSW	6	108381270	missense	probably damaging	1.00
R3930:Itpr1	UTSW	6	108394841	missense	probably benign
R4081:Itpr1	UTSW	6	108391835	missense	probably damaging	1.00
R4119:Itpr1	UTSW	6	108394355	missense	probably benign
R4406:Itpr1	UTSW	6	108354663	missense	probably damaging	1.00
R4506:Itpr1	UTSW	6	108432686	missense	probably damaging	1.00
R4616:Itpr1	UTSW	6	108481223	missense	probably damaging	1.00
R4655:Itpr1	UTSW	6	108481293	missense	probably damaging	1.00
R4661:Itpr1	UTSW	6	108410931	critical splice donor site	probably null
R4760:Itpr1	UTSW	6	108349632	missense	probably benign	0.29
R4836:Itpr1	UTSW	6	108389537	missense	probably damaging	0.99
R4857:Itpr1	UTSW	6	108410867	missense	probably benign	0.00
R4876:Itpr1	UTSW	6	108482906	missense	probably damaging	0.97
R4939:Itpr1	UTSW	6	108440558	nonsense	probably null
R5076:Itpr1	UTSW	6	108405529	splice site	probably null
R5088:Itpr1	UTSW	6	108389387	missense	probably damaging	1.00
R5248:Itpr1	UTSW	6	108542062	missense	probably damaging	1.00
R5290:Itpr1	UTSW	6	108406145	missense	possibly damaging	0.95
R5308:Itpr1	UTSW	6	108356511	missense	probably damaging	1.00
R5339:Itpr1	UTSW	6	108393961	missense	probably damaging	1.00
R5368:Itpr1	UTSW	6	108387498	missense	probably damaging	1.00
R5369:Itpr1	UTSW	6	108519424	missense	probably damaging	0.99
R5419:Itpr1	UTSW	6	108493794	missense	possibly damaging	0.95
R5615:Itpr1	UTSW	6	108488600	missense	possibly damaging	0.71
R5779:Itpr1	UTSW	6	108352143	missense	probably damaging	1.00
R5781:Itpr1	UTSW	6	108510738	missense	probably benign	0.23
R5869:Itpr1	UTSW	6	108473529	missense	probably benign	0.30
R5903:Itpr1	UTSW	6	108489797	intron	probably benign
R5929:Itpr1	UTSW	6	108423336	missense	probably benign
R5956:Itpr1	UTSW	6	108506027	missense	probably benign	0.25
R6160:Itpr1	UTSW	6	108518755	missense	probably benign	0.06
R6163:Itpr1	UTSW	6	108388284	missense	probably damaging	1.00
R6169:Itpr1	UTSW	6	108369116	missense	probably damaging	1.00
R6237:Itpr1	UTSW	6	108378203	missense	possibly damaging	0.53
R6398:Itpr1	UTSW	6	108505903	missense	probably damaging	0.96
R6455:Itpr1	UTSW	6	108417972	missense	probably damaging	1.00
R6522:Itpr1	UTSW	6	108388276	missense	probably damaging	1.00
R6524:Itpr1	UTSW	6	108363683	missense	probably damaging	1.00
R6650:Itpr1	UTSW	6	108394073	splice site	probably null
R6806:Itpr1	UTSW	6	108515947	missense	probably benign
R6838:Itpr1	UTSW	6	108471191	missense	possibly damaging	0.87
R6841:Itpr1	UTSW	6	108388192	missense	probably damaging	1.00
R6896:Itpr1	UTSW	6	108481394	missense	probably damaging	1.00
R7014:Itpr1	UTSW	6	108431498	critical splice donor site	probably null
R7076:Itpr1	UTSW	6	108388296	missense	probably benign
R7116:Itpr1	UTSW	6	108481268	missense	probably damaging	0.99
R7152:Itpr1	UTSW	6	108394407	critical splice donor site	probably null
R7161:Itpr1	UTSW	6	108386640	missense	probably damaging	1.00
R7166:Itpr1	UTSW	6	108378190	missense	probably benign	0.06
R7241:Itpr1	UTSW	6	108517620	critical splice donor site	probably null
R7301:Itpr1	UTSW	6	108542024	missense	possibly damaging	0.86
R7330:Itpr1	UTSW	6	108438331	missense	probably benign	0.28
R7449:Itpr1	UTSW	6	108389384	missense	probably damaging	0.98
R7472:Itpr1	UTSW	6	108403396	missense	probably benign	0.05
R7502:Itpr1	UTSW	6	108383678	missense	probably benign	0.00
R7779:Itpr1	UTSW	6	108523348	missense	possibly damaging	0.75
R7828:Itpr1	UTSW	6	108482931	missense	probably damaging	1.00
R7854:Itpr1	UTSW	6	108387369	missense	probably damaging	1.00
R7974:Itpr1	UTSW	6	108523405	missense	possibly damaging	0.86
R7998:Itpr1	UTSW	6	108417948	missense	possibly damaging	0.88
R8039:Itpr1	UTSW	6	108386628	missense	probably damaging	1.00
R8136:Itpr1	UTSW	6	108438360	missense	probably benign	0.18
R8200:Itpr1	UTSW	6	108394865	missense	probably benign	0.00
R8242:Itpr1	UTSW	6	108386697	missense	probably benign	0.44
R8322:Itpr1	UTSW	6	108388229	missense	probably benign	0.05
R8377:Itpr1	UTSW	6	108510738	missense	probably benign	0.00
R8412:Itpr1	UTSW	6	108363620	missense	probably benign	0.07
R8443:Itpr1	UTSW	6	108519348	missense	probably damaging	0.99
R8669:Itpr1	UTSW	6	108393967	missense	probably damaging	0.99
R8697:Itpr1	UTSW	6	108523366	missense	probably damaging	1.00
R8744:Itpr1	UTSW	6	108377802	missense	possibly damaging	0.79
R8870:Itpr1	UTSW	6	108388211	missense	probably damaging	1.00
R8921:Itpr1	UTSW	6	108378198	missense	possibly damaging	0.87
R8961:Itpr1	UTSW	6	108493705	missense	possibly damaging	0.86
R9095:Itpr1	UTSW	6	108387391	missense	probably benign	0.02
R9205:Itpr1	UTSW	6	108489849	missense	probably damaging	0.99
R9282:Itpr1	UTSW	6	108394023	missense	probably damaging	1.00
R9323:Itpr1	UTSW	6	108352018	missense	probably damaging	1.00
R9376:Itpr1	UTSW	6	108349677	missense	probably damaging	0.99
R9392:Itpr1	UTSW	6	108413876	missense	probably benign
R9428:Itpr1	UTSW	6	108401347	missense	possibly damaging	0.84
R9621:Itpr1	UTSW	6	108416909	missense	probably damaging	1.00
R9632:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9646:Itpr1	UTSW	6	108394884	missense	probably damaging	1.00
R9695:Itpr1	UTSW	6	108401350	missense	probably damaging	1.00
R9710:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9721:Itpr1	UTSW	6	108406102	missense	probably damaging	0.96
R9780:Itpr1	UTSW	6	108510834	missense	probably benign	0.03
Z1176:Itpr1	UTSW	6	108499149	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTATTATGCAGCTCCGTTAGCCCC -3'
(R):5'- GGATACAGAAGGACACTCTCCTGTCAC -3'

Sequencing Primer
(F):5'- AGGCAAGGCTTTTAGCCTGT -3'
(R):5'- CCTCCAAGTCTTAGGGATGAAAATC -3'

Posted On

2013-04-24