Incidental Mutation 'R4080:Stard13'
ID316810
Institutional Source Beutler Lab
Gene Symbol Stard13
Ensembl Gene ENSMUSG00000016128
Gene NameStAR-related lipid transfer (START) domain containing 13
SynonymsGT650, DLC2
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location151037510-151233836 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to A at 151092829 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000110483] [ENSMUST00000126770] [ENSMUST00000126770] [ENSMUST00000126770] [ENSMUST00000126770] [ENSMUST00000129088] [ENSMUST00000129088] [ENSMUST00000129088] [ENSMUST00000129088] [ENSMUST00000202111] [ENSMUST00000202111] [ENSMUST00000202111] [ENSMUST00000202111] [ENSMUST00000202365] [ENSMUST00000202365] [ENSMUST00000202365] [ENSMUST00000202365]
Predicted Effect probably null
Transcript: ENSMUST00000062015
SMART Domains Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Pfam:SAM_2 59 120 2.6e-6 PFAM
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 693 884 2.37e-50 SMART
START 927 1129 2.08e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000062015
SMART Domains Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Pfam:SAM_2 59 120 2.6e-6 PFAM
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 693 884 2.37e-50 SMART
START 927 1129 2.08e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110483
SMART Domains Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
PDB:2JW2|A 50 120 1e-37 PDB
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 674 865 2.37e-50 SMART
START 908 1110 2.08e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110483
SMART Domains Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
PDB:2JW2|A 50 120 1e-37 PDB
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 674 865 2.37e-50 SMART
START 908 1110 2.08e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126770
SMART Domains Protein: ENSMUSP00000122468
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Pfam:SAM_2 44 105 7.6e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126770
SMART Domains Protein: ENSMUSP00000122468
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Pfam:SAM_2 44 105 7.6e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126770
SMART Domains Protein: ENSMUSP00000122468
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Pfam:SAM_2 44 105 7.6e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126770
SMART Domains Protein: ENSMUSP00000122468
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Pfam:SAM_2 44 105 7.6e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129088
SMART Domains Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Blast:SAM 40 104 6e-32 BLAST
PDB:2JW2|A 42 104 8e-33 PDB
Predicted Effect probably null
Transcript: ENSMUST00000129088
SMART Domains Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Blast:SAM 40 104 6e-32 BLAST
PDB:2JW2|A 42 104 8e-33 PDB
Predicted Effect probably null
Transcript: ENSMUST00000129088
SMART Domains Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Blast:SAM 40 104 6e-32 BLAST
PDB:2JW2|A 42 104 8e-33 PDB
Predicted Effect probably null
Transcript: ENSMUST00000129088
SMART Domains Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Blast:SAM 40 104 6e-32 BLAST
PDB:2JW2|A 42 104 8e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201680
Predicted Effect probably null
Transcript: ENSMUST00000202111
SMART Domains Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
RhoGAP 556 747 1.4e-52 SMART
START 790 992 1.4e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202111
SMART Domains Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
RhoGAP 556 747 1.4e-52 SMART
START 790 992 1.4e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202111
SMART Domains Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
RhoGAP 556 747 1.4e-52 SMART
START 790 992 1.4e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202111
SMART Domains Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
RhoGAP 556 747 1.4e-52 SMART
START 790 992 1.4e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202365
Predicted Effect probably null
Transcript: ENSMUST00000202365
Predicted Effect probably null
Transcript: ENSMUST00000202365
Predicted Effect probably null
Transcript: ENSMUST00000202365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202866
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Stard13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Stard13 APN 5 151042239 missense probably damaging 1.00
IGL01362:Stard13 APN 5 151189952 missense probably benign 0.05
IGL01588:Stard13 APN 5 151045237 missense probably damaging 1.00
IGL01947:Stard13 APN 5 151062844 missense probably damaging 1.00
IGL02294:Stard13 APN 5 151063115 missense probably benign 0.19
IGL02713:Stard13 APN 5 151042186 nonsense probably null
IGL02746:Stard13 APN 5 151046857 splice site probably benign
IGL02827:Stard13 APN 5 151063126 missense probably benign 0.07
R0498:Stard13 UTSW 5 151052477 missense probably damaging 1.00
R1427:Stard13 UTSW 5 151045991 missense probably damaging 0.99
R1785:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R1857:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R1858:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R2130:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2131:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2132:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2133:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2258:Stard13 UTSW 5 151039731 missense probably damaging 1.00
R3435:Stard13 UTSW 5 151042179 missense probably damaging 1.00
R4081:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4082:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4233:Stard13 UTSW 5 151062699 missense probably benign 0.00
R4288:Stard13 UTSW 5 151045177 missense probably damaging 1.00
R4303:Stard13 UTSW 5 151062869 missense possibly damaging 0.82
R4659:Stard13 UTSW 5 151062788 missense probably benign 0.01
R4695:Stard13 UTSW 5 151060815 missense probably benign 0.08
R4910:Stard13 UTSW 5 151062527 missense probably benign
R5135:Stard13 UTSW 5 151062767 nonsense probably null
R5338:Stard13 UTSW 5 151059598 missense probably damaging 1.00
R5399:Stard13 UTSW 5 151047801 nonsense probably null
R5546:Stard13 UTSW 5 151045901 missense probably benign 0.03
R5685:Stard13 UTSW 5 151063127 missense possibly damaging 0.78
R5771:Stard13 UTSW 5 151190011 missense probably damaging 1.00
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6141:Stard13 UTSW 5 151042242 missense probably damaging 1.00
R6171:Stard13 UTSW 5 151092762 missense probably damaging 1.00
R6296:Stard13 UTSW 5 151062673 missense probably damaging 1.00
R6326:Stard13 UTSW 5 151046919 missense possibly damaging 0.95
R6508:Stard13 UTSW 5 151063289 missense probably benign 0.06
R7252:Stard13 UTSW 5 151063169 missense probably benign 0.01
R7318:Stard13 UTSW 5 151062573 nonsense probably null
R7459:Stard13 UTSW 5 151047599 missense probably damaging 1.00
R7571:Stard13 UTSW 5 151059502 missense probably damaging 0.97
R7696:Stard13 UTSW 5 151060802 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTGACCACAATAAACGTATTTCC -3'
(R):5'- GCACTTACACTGCACTCTCAAG -3'

Sequencing Primer
(F):5'- CCACAATAAACGTATTTCCAAAGTTG -3'
(R):5'- GCACTCTCAAGAGCATTTTCTGTG -3'
Posted On2015-05-15